Incidental Mutation 'R2105:Ltk'
ID230842
Institutional Source Beutler Lab
Gene Symbol Ltk
Ensembl Gene ENSMUSG00000027297
Gene Nameleukocyte tyrosine kinase
Synonyms
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119751320-119760431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119752088 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 710 (E710G)
Ref Sequence ENSEMBL: ENSMUSP00000080774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028758] [ENSMUST00000028759] [ENSMUST00000082130] [ENSMUST00000140224] [ENSMUST00000182203]
Predicted Effect probably benign
Transcript: ENSMUST00000028758
SMART Domains Protein: ENSMUSP00000028758
Gene: ENSMUSG00000027296

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 116 149 N/A INTRINSIC
Pfam:IPK 243 454 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028759
AA Change: E771G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297
AA Change: E771G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082130
AA Change: E710G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297
AA Change: E710G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134295
Predicted Effect probably damaging
Transcript: ENSMUST00000140224
AA Change: E359G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123020
Gene: ENSMUSG00000027297
AA Change: E359G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 1.2e-129 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182203
AA Change: E459G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138201
Gene: ENSMUSG00000027297
AA Change: E459G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 2.61e-127 SMART
low complexity region 512 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Four alternatively spliced transcript variants encoding different isoforms have been described for this gene. These transcripts are expressed in a tissue-specific manner in lymphocytes, brain and neuroblastoma cells, and the encoded isoforms exhibit different subcellular localization. The lymphocyte and brain specific variants initiate translation at non-AUG (CUG) start codons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Ltk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ltk APN 2 119755605 splice site probably benign
IGL01287:Ltk APN 2 119755705 missense probably benign 0.26
IGL01339:Ltk APN 2 119752974 missense probably damaging 1.00
IGL01614:Ltk APN 2 119753487 missense probably damaging 1.00
IGL01827:Ltk APN 2 119752738 missense probably damaging 1.00
IGL02229:Ltk APN 2 119758573 missense probably benign 0.01
Envy UTSW 2 119753035 splice site probably null
R3763:Ltk UTSW 2 119751837 missense probably benign 0.01
R4119:Ltk UTSW 2 119757948 intron probably benign
R4120:Ltk UTSW 2 119757948 intron probably benign
R4257:Ltk UTSW 2 119753004 missense possibly damaging 0.52
R4460:Ltk UTSW 2 119755613 critical splice donor site probably null
R4888:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5121:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5696:Ltk UTSW 2 119759599 missense probably benign 0.00
R5784:Ltk UTSW 2 119754359 nonsense probably null
R6301:Ltk UTSW 2 119751757 missense probably damaging 1.00
R6470:Ltk UTSW 2 119753035 splice site probably null
R6860:Ltk UTSW 2 119754594 nonsense probably null
R7083:Ltk UTSW 2 119752074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAGCACATCAGGGTCC -3'
(R):5'- TATGCCCTACCCTGGACATAC -3'

Sequencing Primer
(F):5'- TCAGCACATCAGGGTCCTGTAATG -3'
(R):5'- TAGACTTCATTGCCACAGGG -3'
Posted On2014-09-18