Mutagenetix > Incidental Mutation

Incidental Mutation 'R2105:Sycp2'

230845

Institutional Source

Beutler Lab

Gene Symbol

Sycp2

Ensembl Gene

ENSMUSG00000060445

Gene Name

synaptonemal complex protein 2

Synonyms

3830402K23Rik, 4930518F03Rik

MMRRC Submission

040109-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2105 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

178345293-178407685 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 178350138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000079909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081134] [ENSMUST00000081134] [ENSMUST00000081134] [ENSMUST00000081134]

AlphaFold

Q9CUU3

Predicted Effect

probably null
Transcript: ENSMUST00000081134

SMART Domains

Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

Domain	Start	End	E-Value	Type
low complexity region	945	960	N/A	INTRINSIC
low complexity region	1006	1019	N/A	INTRINSIC
low complexity region	1076	1091	N/A	INTRINSIC
low complexity region	1195	1204	N/A	INTRINSIC
low complexity region	1273	1293	N/A	INTRINSIC
low complexity region	1355	1364	N/A	INTRINSIC
coiled coil region	1387	1429	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000081134

SMART Domains

Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

Domain	Start	End	E-Value	Type
low complexity region	945	960	N/A	INTRINSIC
low complexity region	1006	1019	N/A	INTRINSIC
low complexity region	1076	1091	N/A	INTRINSIC
low complexity region	1195	1204	N/A	INTRINSIC
low complexity region	1273	1293	N/A	INTRINSIC
low complexity region	1355	1364	N/A	INTRINSIC
coiled coil region	1387	1429	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000081134

SMART Domains

Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

Domain	Start	End	E-Value	Type
low complexity region	945	960	N/A	INTRINSIC
low complexity region	1006	1019	N/A	INTRINSIC
low complexity region	1076	1091	N/A	INTRINSIC
low complexity region	1195	1204	N/A	INTRINSIC
low complexity region	1273	1293	N/A	INTRINSIC
low complexity region	1355	1364	N/A	INTRINSIC
coiled coil region	1387	1429	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000081134

SMART Domains

Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

Domain	Start	End	E-Value	Type
low complexity region	945	960	N/A	INTRINSIC
low complexity region	1006	1019	N/A	INTRINSIC
low complexity region	1076	1091	N/A	INTRINSIC
low complexity region	1195	1204	N/A	INTRINSIC
low complexity region	1273	1293	N/A	INTRINSIC
low complexity region	1355	1364	N/A	INTRINSIC
coiled coil region	1387	1429	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132611

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,673,500	P1189L	probably benign	Het
Acbd4	G	A	11: 103,104,439	D57N	probably damaging	Het
Acot4	A	T	12: 84,038,742	M78L	probably damaging	Het
Ago1	A	T	4: 126,461,788	M76K	probably benign	Het
Agrn	G	T	4: 156,177,299	Y511*	probably null	Het
Arhgef15	A	T	11: 68,947,681		probably null	Het
Atp1a3	A	T	7: 24,989,853	M594K	probably damaging	Het
Atp4a	G	A	7: 30,720,368		probably null	Het
Bckdk	T	A	7: 127,907,317	I272N	probably damaging	Het
Bod1l	A	G	5: 41,832,279	V367A	probably benign	Het
C1galt1c1	T	C	X: 38,631,268	M284V	possibly damaging	Het
Cenpk	T	A	13: 104,229,597	C4*	probably null	Het
Cfap53	T	C	18: 74,283,223	V9A	possibly damaging	Het
Chil3	T	C	3: 106,160,478	I124V	possibly damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Cyp2c67	T	C	19: 39,626,237	Y282C	probably benign	Het
D5Ertd579e	C	T	5: 36,613,449	A1201T	probably benign	Het
Dock4	A	G	12: 40,692,989	H381R	probably benign	Het
Drc1	C	T	5: 30,356,441	S447F	probably benign	Het
Fam83g	G	T	11: 61,703,458	R606L	probably benign	Het
Fmnl1	A	C	11: 103,194,692	S688R	probably benign	Het
Fryl	C	T	5: 73,122,299	V219I	probably benign	Het
Gm13101	A	T	4: 143,965,820	Y204N	probably benign	Het
Golgb1	T	A	16: 36,914,664	N1424K	probably benign	Het
Gpr39	T	C	1: 125,677,884	V183A	possibly damaging	Het
H2-T22	A	T	17: 36,040,517	Y274N	probably benign	Het
Hif1a	T	A	12: 73,937,745	Y313N	probably damaging	Het
Hip1r	T	A	5: 124,000,204	M787K	probably damaging	Het
Hipk3	T	C	2: 104,439,392	E484G	probably damaging	Het
Hsh2d	T	A	8: 72,200,646	F291I	probably benign	Het
Ino80	T	C	2: 119,431,929	E692G	probably null	Het
Itgam	T	A	7: 128,081,712	V271D	probably damaging	Het
Kansl1	A	C	11: 104,335,559	I924S	probably damaging	Het
Kcnq2	A	G	2: 181,081,352	C628R	probably benign	Het
Krt78	A	C	15: 101,947,414	V654G	possibly damaging	Het
Lrit2	A	G	14: 37,071,956	T326A	probably damaging	Het
Ltk	T	C	2: 119,752,088	E710G	probably damaging	Het
Lysmd1	T	C	3: 95,134,974	L53S	probably damaging	Het
Mc4r	T	C	18: 66,859,598	Y148C	probably damaging	Het
Mfn2	G	A	4: 147,888,705	Q172*	probably null	Het
Mknk2	A	G	10: 80,668,601	L242P	possibly damaging	Het
Mrpl45	A	T	11: 97,325,747	H167L	probably benign	Het
Myc	T	C	15: 61,988,102	V208A	probably damaging	Het
Myh7b	A	G	2: 155,629,457	E1175G	probably benign	Het
Myo18a	A	T	11: 77,850,234	M1456L	probably benign	Het
Myocd	G	A	11: 65,218,658	Q96*	probably null	Het
Nckap5	T	A	1: 126,026,518	I766F	probably damaging	Het
Ndst1	T	C	18: 60,691,253	E784G	probably benign	Het
Nf1	A	T	11: 79,469,826	R1443S	possibly damaging	Het
Nhlrc3	A	G	3: 53,453,651	W228R	probably damaging	Het
Nup107	G	A	10: 117,773,320	T378I	probably damaging	Het
Olfr1033	C	T	2: 86,041,330	T5I	probably damaging	Het
Olfr1131	A	G	2: 87,628,939	T159A	probably benign	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr524	T	A	7: 140,202,743	D9V	probably benign	Het
Olfr607	T	A	7: 103,460,273		probably null	Het
Olfr98	A	T	17: 37,263,073	M197K	probably benign	Het
Otop1	A	G	5: 38,300,458	D520G	probably benign	Het
Papln	C	T	12: 83,780,236	P712S	probably benign	Het
Pcbd2	T	A	13: 55,733,033	I34N	probably damaging	Het
Pkd1l3	T	A	8: 109,647,573	C29*	probably null	Het
Pou5f1	G	A	17: 35,510,002	V114M	probably benign	Het
Prpf4b	C	A	13: 34,884,231		probably benign	Het
Prr23a1	C	T	9: 98,842,656	P24S	probably damaging	Het
Ptch1	T	A	13: 63,545,245	M65L	probably benign	Het
Rc3h2	A	T	2: 37,399,624	I392K	possibly damaging	Het
Reck	G	T	4: 43,943,195	D916Y	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Ryr1	G	T	7: 29,090,150	T1513K	probably damaging	Het
Sacs	A	G	14: 61,173,441	D55G	possibly damaging	Het
Scn9a	A	G	2: 66,568,183	S28P	probably benign	Het
Scrn3	A	G	2: 73,329,852	M280V	probably damaging	Het
Snx29	C	T	16: 11,511,034	T559I	possibly damaging	Het
Spn	C	T	7: 127,136,241	E109K	probably damaging	Het
Sra1	C	T	18: 36,675,068	R369H	probably benign	Het
Srsf11	C	T	3: 158,019,345	A64T	probably damaging	Het
Stk17b	A	G	1: 53,776,605	S12P	probably benign	Het
Sult1d1	C	A	5: 87,559,802	G153V	probably damaging	Het
Tgfb3	T	C	12: 86,069,769	E165G	possibly damaging	Het
Tns2	C	A	15: 102,107,506	H160N	probably benign	Het
Ubn1	T	A	16: 5,077,224	C711*	probably null	Het
Usp13	A	T	3: 32,901,986	D469V	probably damaging	Het
Vmn1r231	A	T	17: 20,890,118	H178Q	possibly damaging	Het
Vwa1	A	G	4: 155,772,793	S183P	probably damaging	Het
Xpo7	A	G	14: 70,690,991	I424T	probably benign	Het
Zfp109	A	G	7: 24,236,616		probably null	Het

Other mutations in Sycp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Sycp2	APN	2	178382348	missense	probably damaging	1.00
IGL00578:Sycp2	APN	2	178350822	splice site	probably benign
IGL00646:Sycp2	APN	2	178374459	missense	probably benign	0.00
IGL01309:Sycp2	APN	2	178358111	missense	probably benign	0.15
IGL01464:Sycp2	APN	2	178401632	missense	probably damaging	0.96
IGL01539:Sycp2	APN	2	178374695	missense	probably damaging	1.00
IGL01670:Sycp2	APN	2	178378050	missense	probably benign	0.00
IGL02138:Sycp2	APN	2	178358254	missense	probably benign	0.31
IGL02138:Sycp2	APN	2	178401990	nonsense	probably null
IGL02630:Sycp2	APN	2	178401919	missense	probably damaging	1.00
IGL02673:Sycp2	APN	2	178394211	missense	possibly damaging	0.63
IGL02961:Sycp2	APN	2	178380862	missense	probably benign	0.01
IGL03084:Sycp2	APN	2	178391791	unclassified	probably benign
IGL03123:Sycp2	APN	2	178352479	nonsense	probably null
IGL03167:Sycp2	APN	2	178379498	missense	probably damaging	0.99
R0043:Sycp2	UTSW	2	178364711	missense	probably damaging	1.00
R0050:Sycp2	UTSW	2	178364711	missense	probably damaging	1.00
R0096:Sycp2	UTSW	2	178403735	missense	probably damaging	0.99
R0096:Sycp2	UTSW	2	178403735	missense	probably damaging	0.99
R0310:Sycp2	UTSW	2	178381855	missense	probably benign	0.44
R0363:Sycp2	UTSW	2	178346411	splice site	probably benign
R0456:Sycp2	UTSW	2	178381855	missense	probably benign	0.44
R0597:Sycp2	UTSW	2	178356580	missense	possibly damaging	0.54
R0608:Sycp2	UTSW	2	178382404	missense	probably damaging	0.98
R1112:Sycp2	UTSW	2	178352536	missense	probably benign	0.05
R1127:Sycp2	UTSW	2	178374366	missense	possibly damaging	0.72
R1208:Sycp2	UTSW	2	178356628	missense	possibly damaging	0.92
R1208:Sycp2	UTSW	2	178356628	missense	possibly damaging	0.92
R1323:Sycp2	UTSW	2	178347621	missense	possibly damaging	0.50
R1323:Sycp2	UTSW	2	178347621	missense	possibly damaging	0.50
R1413:Sycp2	UTSW	2	178347797	missense	probably benign	0.00
R1557:Sycp2	UTSW	2	178395216	unclassified	probably benign
R1562:Sycp2	UTSW	2	178382385	missense	probably damaging	1.00
R1585:Sycp2	UTSW	2	178351668	missense	possibly damaging	0.50
R1932:Sycp2	UTSW	2	178381957	missense	probably damaging	1.00
R1950:Sycp2	UTSW	2	178402800	missense	probably benign	0.00
R2001:Sycp2	UTSW	2	178378055	missense	probably benign	0.05
R2382:Sycp2	UTSW	2	178378018	critical splice donor site	probably null
R2403:Sycp2	UTSW	2	178403735	nonsense	probably null
R2483:Sycp2	UTSW	2	178374595	missense	probably damaging	0.98
R3003:Sycp2	UTSW	2	178358123	missense	probably benign	0.01
R3418:Sycp2	UTSW	2	178401653	splice site	probably benign
R3686:Sycp2	UTSW	2	178374384	missense	probably benign	0.16
R4038:Sycp2	UTSW	2	178380927	missense	possibly damaging	0.72
R4039:Sycp2	UTSW	2	178380927	missense	possibly damaging	0.72
R4272:Sycp2	UTSW	2	178358224	missense	probably benign	0.04
R4343:Sycp2	UTSW	2	178380947	missense	probably damaging	0.99
R4491:Sycp2	UTSW	2	178374985	missense	probably damaging	1.00
R4534:Sycp2	UTSW	2	178355009	missense	probably damaging	1.00
R4720:Sycp2	UTSW	2	178374432	missense	probably benign	0.11
R4805:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4807:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4808:Sycp2	UTSW	2	178393961	unclassified	probably benign
R4906:Sycp2	UTSW	2	178403657	critical splice donor site	probably null
R4910:Sycp2	UTSW	2	178358224	missense	probably benign	0.04
R5282:Sycp2	UTSW	2	178403761	missense	probably damaging	1.00
R5285:Sycp2	UTSW	2	178392398	splice site	probably null
R5316:Sycp2	UTSW	2	178356503	missense	probably benign	0.00
R5389:Sycp2	UTSW	2	178377702	splice site	probably null
R5621:Sycp2	UTSW	2	178381918	missense	probably benign	0.05
R5652:Sycp2	UTSW	2	178358705	splice site	probably null
R5880:Sycp2	UTSW	2	178374470	missense	possibly damaging	0.92
R6114:Sycp2	UTSW	2	178348245	missense	probably benign	0.25
R6115:Sycp2	UTSW	2	178348245	missense	probably benign	0.25
R6186:Sycp2	UTSW	2	178383560	missense	probably damaging	0.97
R6351:Sycp2	UTSW	2	178363416	missense	probably damaging	1.00
R6509:Sycp2	UTSW	2	178395894	missense	probably damaging	1.00
R6536:Sycp2	UTSW	2	178351648	missense	probably damaging	1.00
R6679:Sycp2	UTSW	2	178380928	missense	probably damaging	0.96
R6687:Sycp2	UTSW	2	178354960	missense	probably damaging	0.99
R6761:Sycp2	UTSW	2	178374351	splice site	probably null
R6786:Sycp2	UTSW	2	178383552	missense	possibly damaging	0.63
R7357:Sycp2	UTSW	2	178403804	splice site	probably null
R7422:Sycp2	UTSW	2	178394151	missense	probably damaging	1.00
R7519:Sycp2	UTSW	2	178346333	makesense	probably null
R7805:Sycp2	UTSW	2	178380858	missense	probably damaging	0.99
R7960:Sycp2	UTSW	2	178404660	missense	probably null	0.90
R8022:Sycp2	UTSW	2	178355062	missense	probably damaging	1.00
R8037:Sycp2	UTSW	2	178403778	missense	probably damaging	1.00
R8038:Sycp2	UTSW	2	178403778	missense	probably damaging	1.00
R8039:Sycp2	UTSW	2	178374585	missense	probably benign	0.05
R8159:Sycp2	UTSW	2	178354977	missense	probably damaging	0.97
R8233:Sycp2	UTSW	2	178356634	missense	probably damaging	1.00
R8436:Sycp2	UTSW	2	178362968	missense	probably benign	0.44
R8437:Sycp2	UTSW	2	178364858	missense	probably damaging	1.00
R8528:Sycp2	UTSW	2	178374533	missense	probably damaging	1.00
R8679:Sycp2	UTSW	2	178350975	missense	probably damaging	0.99
R8711:Sycp2	UTSW	2	178348295	missense	probably benign	0.41
R8843:Sycp2	UTSW	2	178348259	missense	probably damaging	0.99
R9044:Sycp2	UTSW	2	178347824	missense	probably damaging	1.00
R9067:Sycp2	UTSW	2	178347421	critical splice donor site	probably null
R9203:Sycp2	UTSW	2	178355113	missense	probably damaging	1.00
R9263:Sycp2	UTSW	2	178394138	missense	probably damaging	1.00
R9301:Sycp2	UTSW	2	178381857	missense	probably benign	0.00
R9596:Sycp2	UTSW	2	178348419	critical splice donor site	probably null
R9633:Sycp2	UTSW	2	178356461	missense	probably damaging	1.00
R9715:Sycp2	UTSW	2	178394164	missense	probably damaging	1.00
R9748:Sycp2	UTSW	2	178383511	missense	probably damaging	1.00
Z1088:Sycp2	UTSW	2	178374367	missense	probably benign
Z1088:Sycp2	UTSW	2	178381934	missense	probably benign	0.17
Z1176:Sycp2	UTSW	2	178364881	missense	probably damaging	1.00
Z1177:Sycp2	UTSW	2	178380875	missense	probably damaging	1.00
Z1191:Sycp2	UTSW	2	178350869	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTAAGGATCAGACAAGCCATC -3'
(R):5'- TTGTCATTTGTGCCTCAGTAGC -3'

Sequencing Primer
(F):5'- AGGATCAGACAAGCCATCTATTATC -3'
(R):5'- GCCCTATCAAAAGGTTCTGTGAC -3'

Posted On

2014-09-18