Incidental Mutation 'R2105:Srsf11'
ID 230851
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Name serine and arginine-rich splicing factor 11
Synonyms Sfrs11, 2610019N13Rik, 0610009J05Rik
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 157716552-157742311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 157724982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 64 (A64T)
Ref Sequence ENSEMBL: ENSMUSP00000142759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
AlphaFold E9Q6E5
Predicted Effect possibly damaging
Transcript: ENSMUST00000069025
AA Change: A239T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: A239T

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072875
AA Change: A222T

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: A222T

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect probably benign
Transcript: ENSMUST00000121326
AA Change: A257T

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: A257T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126377
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140491
SMART Domains Protein: ENSMUSP00000118767
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
Blast:RRM 2 42 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198705
AA Change: A64T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436
AA Change: A64T

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Predicted Effect probably benign
Transcript: ENSMUST00000147304
SMART Domains Protein: ENSMUSP00000115487
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
RRM 7 81 3.13e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 157,717,672 (GRCm39) unclassified probably benign
IGL01600:Srsf11 APN 3 157,725,079 (GRCm39) splice site probably benign
IGL02724:Srsf11 APN 3 157,722,068 (GRCm39) unclassified probably benign
IGL03147:Srsf11 UTSW 3 157,732,377 (GRCm39) missense probably damaging 1.00
R0195:Srsf11 UTSW 3 157,742,172 (GRCm39) unclassified probably benign
R0578:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R0580:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R1075:Srsf11 UTSW 3 157,718,427 (GRCm39) intron probably benign
R1604:Srsf11 UTSW 3 157,724,948 (GRCm39) critical splice donor site probably null
R1797:Srsf11 UTSW 3 157,725,065 (GRCm39) missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 157,722,064 (GRCm39) unclassified probably benign
R1899:Srsf11 UTSW 3 157,737,217 (GRCm39) unclassified probably benign
R4605:Srsf11 UTSW 3 157,728,560 (GRCm39) nonsense probably null
R4655:Srsf11 UTSW 3 157,728,972 (GRCm39) missense probably benign 0.15
R4737:Srsf11 UTSW 3 157,732,369 (GRCm39) nonsense probably null
R5244:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5245:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5379:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5401:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5625:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5763:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5814:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5938:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5944:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5945:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6126:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6175:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6427:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6435:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6436:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6614:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6616:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R7615:Srsf11 UTSW 3 157,722,062 (GRCm39) missense unknown
R8787:Srsf11 UTSW 3 157,718,037 (GRCm39) missense unknown
R9352:Srsf11 UTSW 3 157,717,836 (GRCm39) missense unknown
R9547:Srsf11 UTSW 3 157,717,735 (GRCm39) missense unknown
X0017:Srsf11 UTSW 3 157,721,986 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCAAAAGAATCTGATTGGCAC -3'
(R):5'- AGTGGCACTTCACTGCATGC -3'

Sequencing Primer
(F):5'- TCTGATTGGCACTGTACTACATG -3'
(R):5'- CTGCTTATTAAAATGGTGGTTCCC -3'
Posted On 2014-09-18