Incidental Mutation 'R2105:Bod1l'
ID230862
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41832279 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably benign
Transcript: ENSMUST00000050556
AA Change: V367A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: V367A

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202200
Predicted Effect probably benign
Transcript: ENSMUST00000202908
AA Change: V367A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: V367A

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCACAGCGTAGTACTTTTATTG -3'
(R):5'- TCAGCAGGAAAGCACTGACC -3'

Sequencing Primer
(F):5'- ACAGCGTAGTACTTTTATTGCTTTAC -3'
(R):5'- GCACTGACCCAAAAATTAAATCAATG -3'
Posted On2014-09-18