Incidental Mutation 'R2105:Fryl'
ID 230863
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 9030227G01Rik, 2310004H21Rik, 2510002A14Rik
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.740) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 73177534-73414042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73279642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 219 (V219I)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127] [ENSMUST00000152631] [ENSMUST00000153903]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: V219I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: V219I

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: V219I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: V219I

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148433
Predicted Effect probably benign
Transcript: ENSMUST00000152631
SMART Domains Protein: ENSMUSP00000115208
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 1 117 5.3e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153903
SMART Domains Protein: ENSMUSP00000119385
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 1 199 4.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153923
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73,305,451 (GRCm39) missense possibly damaging 0.92
IGL01518:Fryl APN 5 73,244,305 (GRCm39) missense possibly damaging 0.76
IGL01545:Fryl APN 5 73,211,940 (GRCm39) missense probably damaging 1.00
IGL01646:Fryl APN 5 73,179,844 (GRCm39) critical splice donor site probably null
IGL01938:Fryl APN 5 73,279,707 (GRCm39) missense probably damaging 0.98
IGL01962:Fryl APN 5 73,190,134 (GRCm39) missense possibly damaging 0.62
IGL02064:Fryl APN 5 73,282,112 (GRCm39) unclassified probably benign
IGL02148:Fryl APN 5 73,233,302 (GRCm39) missense probably benign 0.35
IGL02418:Fryl APN 5 73,267,519 (GRCm39) splice site probably benign
IGL02431:Fryl APN 5 73,255,651 (GRCm39) missense probably benign 0.02
IGL02513:Fryl APN 5 73,222,636 (GRCm39) missense probably damaging 1.00
IGL02557:Fryl APN 5 73,255,736 (GRCm39) missense probably damaging 1.00
IGL02625:Fryl APN 5 73,227,220 (GRCm39) intron probably benign
IGL02642:Fryl APN 5 73,252,809 (GRCm39) missense probably benign
IGL02657:Fryl APN 5 73,212,203 (GRCm39) missense probably benign 0.01
IGL02706:Fryl APN 5 73,250,506 (GRCm39) missense probably benign 0.45
IGL03022:Fryl APN 5 73,216,726 (GRCm39) missense possibly damaging 0.82
IGL03144:Fryl APN 5 73,258,798 (GRCm39) missense probably null 0.22
IGL03155:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03183:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03275:Fryl APN 5 73,305,376 (GRCm39) missense possibly damaging 0.47
IGL03310:Fryl APN 5 73,293,659 (GRCm39) splice site probably benign
IGL03341:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03343:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03350:Fryl APN 5 73,290,649 (GRCm39) missense probably damaging 0.99
IGL03357:Fryl APN 5 73,211,402 (GRCm39) missense probably damaging 1.00
IGL03374:Fryl APN 5 73,267,624 (GRCm39) splice site probably benign
IGL03375:Fryl APN 5 73,245,792 (GRCm39) missense possibly damaging 0.91
bedeviled UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
Besotted UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0308:Fryl UTSW 5 73,198,947 (GRCm39) splice site probably benign
R0312:Fryl UTSW 5 73,230,231 (GRCm39) missense probably damaging 1.00
R0415:Fryl UTSW 5 73,255,757 (GRCm39) missense probably damaging 0.99
R0440:Fryl UTSW 5 73,244,315 (GRCm39) missense possibly damaging 0.91
R0446:Fryl UTSW 5 73,254,760 (GRCm39) missense possibly damaging 0.91
R0566:Fryl UTSW 5 73,221,840 (GRCm39) splice site probably benign
R0567:Fryl UTSW 5 73,222,734 (GRCm39) missense possibly damaging 0.50
R0606:Fryl UTSW 5 73,282,077 (GRCm39) missense probably benign 0.15
R0619:Fryl UTSW 5 73,226,074 (GRCm39) missense probably benign 0.22
R0654:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0658:Fryl UTSW 5 73,222,702 (GRCm39) missense probably damaging 1.00
R0707:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0744:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0745:Fryl UTSW 5 73,228,469 (GRCm39) missense probably damaging 0.96
R0833:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0885:Fryl UTSW 5 73,246,539 (GRCm39) missense probably damaging 0.97
R0894:Fryl UTSW 5 73,198,675 (GRCm39) splice site probably benign
R1076:Fryl UTSW 5 73,282,016 (GRCm39) unclassified probably benign
R1241:Fryl UTSW 5 73,267,614 (GRCm39) missense probably damaging 1.00
R1241:Fryl UTSW 5 73,222,268 (GRCm39) splice site probably benign
R1394:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1395:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1608:Fryl UTSW 5 73,232,094 (GRCm39) nonsense probably null
R1664:Fryl UTSW 5 73,216,778 (GRCm39) missense probably damaging 1.00
R1745:Fryl UTSW 5 73,190,204 (GRCm39) splice site probably benign
R1937:Fryl UTSW 5 73,290,710 (GRCm39) missense probably damaging 1.00
R1969:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R1993:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R1994:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R2029:Fryl UTSW 5 73,179,465 (GRCm39) nonsense probably null
R2036:Fryl UTSW 5 73,265,305 (GRCm39) critical splice donor site probably null
R2036:Fryl UTSW 5 73,179,887 (GRCm39) missense probably benign
R2088:Fryl UTSW 5 73,222,804 (GRCm39) missense probably benign 0.02
R2106:Fryl UTSW 5 73,255,674 (GRCm39) missense probably damaging 1.00
R2186:Fryl UTSW 5 73,222,318 (GRCm39) missense probably damaging 1.00
R2239:Fryl UTSW 5 73,265,890 (GRCm39) missense probably damaging 0.99
R2256:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2257:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2280:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2281:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2911:Fryl UTSW 5 73,207,799 (GRCm39) missense probably damaging 0.99
R3019:Fryl UTSW 5 73,240,193 (GRCm39) missense probably benign 0.01
R3416:Fryl UTSW 5 73,265,417 (GRCm39) missense possibly damaging 0.84
R3783:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3787:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3837:Fryl UTSW 5 73,228,608 (GRCm39) missense probably benign 0.03
R3969:Fryl UTSW 5 73,269,766 (GRCm39) missense probably damaging 0.97
R4387:Fryl UTSW 5 73,243,903 (GRCm39) missense possibly damaging 0.91
R4502:Fryl UTSW 5 73,245,740 (GRCm39) missense probably damaging 1.00
R4658:Fryl UTSW 5 73,238,396 (GRCm39) missense probably damaging 1.00
R4664:Fryl UTSW 5 73,248,022 (GRCm39) missense possibly damaging 0.80
R4690:Fryl UTSW 5 73,257,636 (GRCm39) missense probably benign
R4700:Fryl UTSW 5 73,222,881 (GRCm39) missense possibly damaging 0.88
R4709:Fryl UTSW 5 73,238,315 (GRCm39) missense probably benign 0.03
R4807:Fryl UTSW 5 73,198,705 (GRCm39) missense probably benign 0.00
R4912:Fryl UTSW 5 73,226,125 (GRCm39) frame shift probably null
R4948:Fryl UTSW 5 73,246,473 (GRCm39) missense probably benign 0.08
R4959:Fryl UTSW 5 73,192,401 (GRCm39) missense probably benign 0.00
R5062:Fryl UTSW 5 73,233,236 (GRCm39) missense possibly damaging 0.89
R5067:Fryl UTSW 5 73,215,098 (GRCm39) missense probably benign 0.13
R5071:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5072:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5073:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5074:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5139:Fryl UTSW 5 73,248,061 (GRCm39) missense probably damaging 1.00
R5172:Fryl UTSW 5 73,259,016 (GRCm39) missense possibly damaging 0.95
R5187:Fryl UTSW 5 73,243,943 (GRCm39) missense possibly damaging 0.95
R5272:Fryl UTSW 5 73,222,479 (GRCm39) nonsense probably null
R5275:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5295:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5344:Fryl UTSW 5 73,262,117 (GRCm39) missense probably damaging 1.00
R5355:Fryl UTSW 5 73,231,247 (GRCm39) missense probably damaging 1.00
R5716:Fryl UTSW 5 73,257,808 (GRCm39) missense probably benign
R5778:Fryl UTSW 5 73,230,121 (GRCm39) missense probably damaging 1.00
R5810:Fryl UTSW 5 73,248,098 (GRCm39) missense probably benign 0.06
R5934:Fryl UTSW 5 73,248,060 (GRCm39) missense probably damaging 1.00
R5948:Fryl UTSW 5 73,254,715 (GRCm39) critical splice donor site probably null
R6005:Fryl UTSW 5 73,240,638 (GRCm39) missense probably damaging 1.00
R6026:Fryl UTSW 5 73,257,340 (GRCm39) missense probably benign 0.04
R6045:Fryl UTSW 5 73,275,894 (GRCm39) missense probably damaging 0.99
R6185:Fryl UTSW 5 73,270,131 (GRCm39) missense probably benign 0.43
R6247:Fryl UTSW 5 73,222,824 (GRCm39) missense probably damaging 0.98
R6294:Fryl UTSW 5 73,349,102 (GRCm39) intron probably benign
R6310:Fryl UTSW 5 73,349,104 (GRCm39) intron probably benign
R6429:Fryl UTSW 5 73,248,094 (GRCm39) missense possibly damaging 0.84
R6568:Fryl UTSW 5 73,216,859 (GRCm39) missense probably damaging 1.00
R6636:Fryl UTSW 5 73,290,655 (GRCm39) missense probably benign 0.01
R6664:Fryl UTSW 5 73,289,824 (GRCm39) missense probably damaging 1.00
R6732:Fryl UTSW 5 73,212,124 (GRCm39) missense probably damaging 1.00
R6750:Fryl UTSW 5 73,179,575 (GRCm39) missense probably damaging 1.00
R6805:Fryl UTSW 5 73,222,437 (GRCm39) missense probably benign 0.03
R6823:Fryl UTSW 5 73,222,560 (GRCm39) missense probably damaging 0.99
R6855:Fryl UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
R6858:Fryl UTSW 5 73,222,375 (GRCm39) missense probably damaging 1.00
R6868:Fryl UTSW 5 73,226,146 (GRCm39) missense probably damaging 1.00
R6898:Fryl UTSW 5 73,179,485 (GRCm39) missense probably damaging 0.96
R6908:Fryl UTSW 5 73,179,554 (GRCm39) missense probably damaging 1.00
R6958:Fryl UTSW 5 73,231,272 (GRCm39) missense possibly damaging 0.89
R6980:Fryl UTSW 5 73,207,773 (GRCm39) missense probably benign 0.06
R7036:Fryl UTSW 5 73,212,951 (GRCm39) missense probably benign 0.03
R7065:Fryl UTSW 5 73,248,099 (GRCm39) missense probably damaging 0.96
R7097:Fryl UTSW 5 73,231,251 (GRCm39) missense probably benign 0.31
R7171:Fryl UTSW 5 73,279,653 (GRCm39) missense probably damaging 0.97
R7191:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R7207:Fryl UTSW 5 73,222,438 (GRCm39) missense probably benign
R7236:Fryl UTSW 5 73,265,821 (GRCm39) missense possibly damaging 0.66
R7334:Fryl UTSW 5 73,204,839 (GRCm39) splice site probably null
R7425:Fryl UTSW 5 73,262,091 (GRCm39) missense probably damaging 1.00
R7452:Fryl UTSW 5 73,181,331 (GRCm39) missense probably damaging 1.00
R7479:Fryl UTSW 5 73,254,904 (GRCm39) missense possibly damaging 0.71
R7535:Fryl UTSW 5 73,255,539 (GRCm39) missense probably benign 0.15
R7538:Fryl UTSW 5 73,180,019 (GRCm39) missense probably benign 0.09
R7544:Fryl UTSW 5 73,238,382 (GRCm39) missense probably benign
R7548:Fryl UTSW 5 73,349,105 (GRCm39) missense unknown
R7565:Fryl UTSW 5 73,191,063 (GRCm39) missense probably benign 0.18
R7572:Fryl UTSW 5 73,245,739 (GRCm39) missense possibly damaging 0.91
R7582:Fryl UTSW 5 73,179,843 (GRCm39) critical splice donor site probably null
R7630:Fryl UTSW 5 73,267,588 (GRCm39) missense possibly damaging 0.62
R7774:Fryl UTSW 5 73,240,727 (GRCm39) missense probably benign 0.12
R7777:Fryl UTSW 5 73,228,641 (GRCm39) missense probably damaging 0.98
R7917:Fryl UTSW 5 73,211,875 (GRCm39) missense probably damaging 1.00
R7920:Fryl UTSW 5 73,259,150 (GRCm39) splice site probably null
R8110:Fryl UTSW 5 73,290,620 (GRCm39) missense probably benign 0.10
R8120:Fryl UTSW 5 73,228,527 (GRCm39) missense probably benign 0.01
R8143:Fryl UTSW 5 73,207,682 (GRCm39) missense probably benign 0.00
R8207:Fryl UTSW 5 73,257,843 (GRCm39) splice site probably null
R8263:Fryl UTSW 5 73,238,348 (GRCm39) missense probably damaging 1.00
R8350:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8359:Fryl UTSW 5 73,233,276 (GRCm39) missense probably benign 0.39
R8387:Fryl UTSW 5 73,293,663 (GRCm39) critical splice donor site probably null
R8403:Fryl UTSW 5 73,275,790 (GRCm39) makesense probably null
R8450:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8514:Fryl UTSW 5 73,242,699 (GRCm39) missense probably benign
R8536:Fryl UTSW 5 73,257,696 (GRCm39) missense probably damaging 0.99
R8703:Fryl UTSW 5 73,247,997 (GRCm39) missense probably damaging 0.99
R8708:Fryl UTSW 5 73,289,905 (GRCm39) missense probably benign 0.01
R8783:Fryl UTSW 5 73,226,185 (GRCm39) missense probably benign 0.45
R9028:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R9045:Fryl UTSW 5 73,182,118 (GRCm39) missense
R9063:Fryl UTSW 5 73,238,346 (GRCm39) missense possibly damaging 0.70
R9096:Fryl UTSW 5 73,265,920 (GRCm39) missense probably benign 0.01
R9244:Fryl UTSW 5 73,348,862 (GRCm39) intron probably benign
R9345:Fryl UTSW 5 73,207,754 (GRCm39) missense probably benign
R9381:Fryl UTSW 5 73,240,637 (GRCm39) missense probably benign 0.24
R9386:Fryl UTSW 5 73,349,152 (GRCm39) missense unknown
R9401:Fryl UTSW 5 73,222,563 (GRCm39) nonsense probably null
R9497:Fryl UTSW 5 73,215,134 (GRCm39) missense
R9514:Fryl UTSW 5 73,262,115 (GRCm39) missense probably damaging 1.00
R9570:Fryl UTSW 5 73,179,498 (GRCm39) missense probably benign 0.02
R9654:Fryl UTSW 5 73,275,801 (GRCm39) missense probably benign
R9665:Fryl UTSW 5 73,222,299 (GRCm39) missense probably damaging 1.00
R9685:Fryl UTSW 5 73,216,879 (GRCm39) missense probably damaging 0.99
R9798:Fryl UTSW 5 73,192,402 (GRCm39) missense probably benign
Z1088:Fryl UTSW 5 73,248,081 (GRCm39) missense probably damaging 1.00
Z1088:Fryl UTSW 5 73,248,052 (GRCm39) missense probably damaging 0.99
Z1176:Fryl UTSW 5 73,230,180 (GRCm39) missense probably benign
Z1177:Fryl UTSW 5 73,198,938 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAAGGATAGTCATCACATGTG -3'
(R):5'- GCAGAGTATGTGTCCTTCCG -3'

Sequencing Primer
(F):5'- TTTGGGGCTCACTGTAAC -3'
(R):5'- CAGAGTATGTGTCCTTCCGGATAAAG -3'
Posted On 2014-09-18