Incidental Mutation 'R2105:A2m'
ID 230867
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Name alpha-2-macroglobulin
Synonyms A2mp
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2105 (G1)
Quality Score 167
Status Not validated
Chromosome 6
Chromosomal Location 121612920-121656197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121650459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1189 (P1189L)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
AlphaFold Q6GQT1
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: P1189L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: P1189L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121,621,108 (GRCm39) missense possibly damaging 0.67
IGL00798:A2m APN 6 121,647,969 (GRCm39) missense probably damaging 1.00
IGL01154:A2m APN 6 121,650,501 (GRCm39) nonsense probably null
IGL01313:A2m APN 6 121,621,969 (GRCm39) critical splice donor site probably null
IGL01337:A2m APN 6 121,645,529 (GRCm39) missense probably damaging 0.98
IGL01505:A2m APN 6 121,653,906 (GRCm39) missense possibly damaging 0.83
IGL01508:A2m APN 6 121,636,326 (GRCm39) nonsense probably null
IGL01672:A2m APN 6 121,618,316 (GRCm39) missense probably damaging 1.00
IGL01951:A2m APN 6 121,644,149 (GRCm39) missense possibly damaging 0.78
IGL02012:A2m APN 6 121,651,820 (GRCm39) missense probably damaging 1.00
IGL02066:A2m APN 6 121,626,854 (GRCm39) missense probably damaging 1.00
IGL02234:A2m APN 6 121,645,179 (GRCm39) missense possibly damaging 0.67
IGL02397:A2m APN 6 121,623,834 (GRCm39) missense probably benign
IGL02407:A2m APN 6 121,645,575 (GRCm39) nonsense probably null
IGL02408:A2m APN 6 121,621,130 (GRCm39) missense probably damaging 0.99
IGL02469:A2m APN 6 121,645,074 (GRCm39) missense probably damaging 1.00
IGL02527:A2m APN 6 121,638,392 (GRCm39) missense probably damaging 0.99
IGL02612:A2m APN 6 121,654,971 (GRCm39) missense probably benign
IGL02746:A2m APN 6 121,646,462 (GRCm39) splice site probably benign
IGL02952:A2m APN 6 121,654,984 (GRCm39) missense probably damaging 0.99
IGL03056:A2m APN 6 121,647,862 (GRCm39) missense probably damaging 0.96
IGL03121:A2m APN 6 121,618,265 (GRCm39) missense probably benign 0.02
IGL03303:A2m APN 6 121,644,122 (GRCm39) missense probably damaging 1.00
IGL03369:A2m APN 6 121,653,862 (GRCm39) critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121,636,282 (GRCm39) missense probably benign 0.04
R0040:A2m UTSW 6 121,622,165 (GRCm39) missense possibly damaging 0.93
R0049:A2m UTSW 6 121,615,267 (GRCm39) missense possibly damaging 0.77
R0049:A2m UTSW 6 121,615,267 (GRCm39) missense possibly damaging 0.77
R0109:A2m UTSW 6 121,636,262 (GRCm39) missense probably benign 0.00
R0147:A2m UTSW 6 121,639,405 (GRCm39) critical splice donor site probably null
R0148:A2m UTSW 6 121,639,405 (GRCm39) critical splice donor site probably null
R0345:A2m UTSW 6 121,615,231 (GRCm39) splice site probably benign
R0445:A2m UTSW 6 121,634,914 (GRCm39) missense probably damaging 1.00
R0766:A2m UTSW 6 121,653,849 (GRCm39) splice site probably benign
R1186:A2m UTSW 6 121,638,493 (GRCm39) missense probably benign 0.00
R1436:A2m UTSW 6 121,621,172 (GRCm39) missense probably benign 0.09
R1452:A2m UTSW 6 121,655,015 (GRCm39) missense probably benign 0.01
R1636:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1637:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1638:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1698:A2m UTSW 6 121,622,117 (GRCm39) missense possibly damaging 0.88
R1776:A2m UTSW 6 121,618,383 (GRCm39) missense probably damaging 1.00
R1791:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1918:A2m UTSW 6 121,621,895 (GRCm39) missense probably benign 0.16
R1921:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1927:A2m UTSW 6 121,613,338 (GRCm39) missense probably damaging 1.00
R1934:A2m UTSW 6 121,626,792 (GRCm39) missense probably damaging 0.98
R1943:A2m UTSW 6 121,645,506 (GRCm39) missense possibly damaging 0.90
R1996:A2m UTSW 6 121,646,556 (GRCm39) missense probably damaging 1.00
R2039:A2m UTSW 6 121,636,908 (GRCm39) missense probably benign 0.32
R2085:A2m UTSW 6 121,653,918 (GRCm39) missense probably damaging 1.00
R2092:A2m UTSW 6 121,651,896 (GRCm39) nonsense probably null
R2107:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R2235:A2m UTSW 6 121,619,023 (GRCm39) missense probably benign 0.21
R2292:A2m UTSW 6 121,650,518 (GRCm39) missense possibly damaging 0.90
R2350:A2m UTSW 6 121,655,047 (GRCm39) splice site probably benign
R3001:A2m UTSW 6 121,638,406 (GRCm39) missense possibly damaging 0.88
R3002:A2m UTSW 6 121,638,406 (GRCm39) missense possibly damaging 0.88
R3023:A2m UTSW 6 121,646,531 (GRCm39) missense probably benign 0.08
R3429:A2m UTSW 6 121,613,249 (GRCm39) start codon destroyed probably null
R3437:A2m UTSW 6 121,616,253 (GRCm39) missense probably null 0.03
R3909:A2m UTSW 6 121,625,125 (GRCm39) missense probably damaging 1.00
R4300:A2m UTSW 6 121,650,434 (GRCm39) missense probably benign 0.00
R4332:A2m UTSW 6 121,634,406 (GRCm39) missense probably benign 0.01
R4584:A2m UTSW 6 121,634,365 (GRCm39) missense probably benign 0.07
R4697:A2m UTSW 6 121,615,243 (GRCm39) start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121,618,262 (GRCm39) missense probably benign 0.03
R4841:A2m UTSW 6 121,623,803 (GRCm39) missense probably benign 0.06
R5206:A2m UTSW 6 121,651,766 (GRCm39) missense probably damaging 1.00
R5219:A2m UTSW 6 121,653,909 (GRCm39) missense possibly damaging 0.90
R5230:A2m UTSW 6 121,651,820 (GRCm39) missense probably damaging 1.00
R5330:A2m UTSW 6 121,615,375 (GRCm39) missense probably benign 0.11
R5331:A2m UTSW 6 121,615,375 (GRCm39) missense probably benign 0.11
R5377:A2m UTSW 6 121,622,212 (GRCm39) missense probably benign
R5590:A2m UTSW 6 121,653,891 (GRCm39) missense probably damaging 1.00
R5835:A2m UTSW 6 121,616,295 (GRCm39) missense probably damaging 1.00
R5910:A2m UTSW 6 121,645,076 (GRCm39) missense probably damaging 1.00
R5915:A2m UTSW 6 121,644,122 (GRCm39) missense probably damaging 1.00
R5949:A2m UTSW 6 121,655,032 (GRCm39) missense probably damaging 1.00
R5994:A2m UTSW 6 121,647,862 (GRCm39) missense probably benign 0.38
R5996:A2m UTSW 6 121,636,353 (GRCm39) missense probably damaging 1.00
R6035:A2m UTSW 6 121,615,353 (GRCm39) missense probably damaging 0.99
R6035:A2m UTSW 6 121,615,353 (GRCm39) missense probably damaging 0.99
R6090:A2m UTSW 6 121,624,972 (GRCm39) missense probably benign 0.45
R6241:A2m UTSW 6 121,623,788 (GRCm39) missense probably benign 0.09
R6294:A2m UTSW 6 121,631,440 (GRCm39) missense probably benign
R6492:A2m UTSW 6 121,631,464 (GRCm39) missense probably benign 0.35
R6554:A2m UTSW 6 121,618,246 (GRCm39) missense probably damaging 1.00
R6597:A2m UTSW 6 121,625,080 (GRCm39) missense probably damaging 1.00
R6742:A2m UTSW 6 121,654,995 (GRCm39) missense probably benign 0.01
R6795:A2m UTSW 6 121,625,281 (GRCm39) splice site probably null
R6843:A2m UTSW 6 121,615,360 (GRCm39) missense probably benign 0.01
R7013:A2m UTSW 6 121,618,345 (GRCm39) missense probably null 0.00
R7137:A2m UTSW 6 121,654,944 (GRCm39) missense possibly damaging 0.85
R7167:A2m UTSW 6 121,624,930 (GRCm39) missense probably benign
R7294:A2m UTSW 6 121,650,541 (GRCm39) nonsense probably null
R7452:A2m UTSW 6 121,618,291 (GRCm39) missense probably damaging 1.00
R7507:A2m UTSW 6 121,652,177 (GRCm39) missense probably benign 0.01
R7602:A2m UTSW 6 121,647,895 (GRCm39) missense possibly damaging 0.79
R7602:A2m UTSW 6 121,618,966 (GRCm39) missense probably damaging 1.00
R7709:A2m UTSW 6 121,637,063 (GRCm39) missense possibly damaging 0.81
R7766:A2m UTSW 6 121,615,300 (GRCm39) missense probably benign 0.08
R7921:A2m UTSW 6 121,654,954 (GRCm39) missense probably benign 0.00
R8007:A2m UTSW 6 121,647,845 (GRCm39) intron probably benign
R8291:A2m UTSW 6 121,655,017 (GRCm39) missense probably damaging 1.00
R8542:A2m UTSW 6 121,634,369 (GRCm39) missense probably benign 0.03
R8856:A2m UTSW 6 121,618,349 (GRCm39) missense probably benign 0.00
R9023:A2m UTSW 6 121,636,917 (GRCm39) missense possibly damaging 0.90
R9154:A2m UTSW 6 121,645,512 (GRCm39) missense probably damaging 1.00
R9156:A2m UTSW 6 121,647,957 (GRCm39) missense probably damaging 0.98
R9255:A2m UTSW 6 121,626,795 (GRCm39) missense probably damaging 1.00
R9269:A2m UTSW 6 121,637,865 (GRCm39) missense probably benign 0.38
R9325:A2m UTSW 6 121,646,578 (GRCm39) missense possibly damaging 0.81
R9393:A2m UTSW 6 121,616,270 (GRCm39) missense possibly damaging 0.91
R9563:A2m UTSW 6 121,645,009 (GRCm39) missense probably damaging 0.99
X0057:A2m UTSW 6 121,645,135 (GRCm39) missense probably damaging 1.00
X0060:A2m UTSW 6 121,653,039 (GRCm39) missense probably damaging 1.00
X0063:A2m UTSW 6 121,623,835 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAATATTTCATCACTCATAAGCA -3'
(R):5'- CGTGGGAATTCTGCTGCTTT -3'

Sequencing Primer
(F):5'- AGACAGCTATATCAGGGTCCTGTC -3'
(R):5'- GCTTTGTGAGCCACTTCACAATGAG -3'
Posted On 2014-09-18