Mutagenetix > Incidental Mutation

Incidental Mutation 'R2105:Atp4a'

230871

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

040109-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R2105 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 30720368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000005692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000005692

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,673,500	P1189L	probably benign	Het
Acbd4	G	A	11: 103,104,439	D57N	probably damaging	Het
Acot4	A	T	12: 84,038,742	M78L	probably damaging	Het
Ago1	A	T	4: 126,461,788	M76K	probably benign	Het
Agrn	G	T	4: 156,177,299	Y511*	probably null	Het
Arhgef15	A	T	11: 68,947,681		probably null	Het
Atp1a3	A	T	7: 24,989,853	M594K	probably damaging	Het
Bckdk	T	A	7: 127,907,317	I272N	probably damaging	Het
Bod1l	A	G	5: 41,832,279	V367A	probably benign	Het
C1galt1c1	T	C	X: 38,631,268	M284V	possibly damaging	Het
Cenpk	T	A	13: 104,229,597	C4*	probably null	Het
Cfap53	T	C	18: 74,283,223	V9A	possibly damaging	Het
Chil3	T	C	3: 106,160,478	I124V	possibly damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Cyp2c67	T	C	19: 39,626,237	Y282C	probably benign	Het
D5Ertd579e	C	T	5: 36,613,449	A1201T	probably benign	Het
Dock4	A	G	12: 40,692,989	H381R	probably benign	Het
Drc1	C	T	5: 30,356,441	S447F	probably benign	Het
Fam83g	G	T	11: 61,703,458	R606L	probably benign	Het
Fmnl1	A	C	11: 103,194,692	S688R	probably benign	Het
Fryl	C	T	5: 73,122,299	V219I	probably benign	Het
Gm13101	A	T	4: 143,965,820	Y204N	probably benign	Het
Golgb1	T	A	16: 36,914,664	N1424K	probably benign	Het
Gpr39	T	C	1: 125,677,884	V183A	possibly damaging	Het
H2-T22	A	T	17: 36,040,517	Y274N	probably benign	Het
Hif1a	T	A	12: 73,937,745	Y313N	probably damaging	Het
Hip1r	T	A	5: 124,000,204	M787K	probably damaging	Het
Hipk3	T	C	2: 104,439,392	E484G	probably damaging	Het
Hsh2d	T	A	8: 72,200,646	F291I	probably benign	Het
Ino80	T	C	2: 119,431,929	E692G	probably null	Het
Itgam	T	A	7: 128,081,712	V271D	probably damaging	Het
Kansl1	A	C	11: 104,335,559	I924S	probably damaging	Het
Kcnq2	A	G	2: 181,081,352	C628R	probably benign	Het
Krt78	A	C	15: 101,947,414	V654G	possibly damaging	Het
Lrit2	A	G	14: 37,071,956	T326A	probably damaging	Het
Ltk	T	C	2: 119,752,088	E710G	probably damaging	Het
Lysmd1	T	C	3: 95,134,974	L53S	probably damaging	Het
Mc4r	T	C	18: 66,859,598	Y148C	probably damaging	Het
Mfn2	G	A	4: 147,888,705	Q172*	probably null	Het
Mknk2	A	G	10: 80,668,601	L242P	possibly damaging	Het
Mrpl45	A	T	11: 97,325,747	H167L	probably benign	Het
Myc	T	C	15: 61,988,102	V208A	probably damaging	Het
Myh7b	A	G	2: 155,629,457	E1175G	probably benign	Het
Myo18a	A	T	11: 77,850,234	M1456L	probably benign	Het
Myocd	G	A	11: 65,218,658	Q96*	probably null	Het
Nckap5	T	A	1: 126,026,518	I766F	probably damaging	Het
Ndst1	T	C	18: 60,691,253	E784G	probably benign	Het
Nf1	A	T	11: 79,469,826	R1443S	possibly damaging	Het
Nhlrc3	A	G	3: 53,453,651	W228R	probably damaging	Het
Nup107	G	A	10: 117,773,320	T378I	probably damaging	Het
Olfr1033	C	T	2: 86,041,330	T5I	probably damaging	Het
Olfr1131	A	G	2: 87,628,939	T159A	probably benign	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr524	T	A	7: 140,202,743	D9V	probably benign	Het
Olfr607	T	A	7: 103,460,273		probably null	Het
Olfr98	A	T	17: 37,263,073	M197K	probably benign	Het
Otop1	A	G	5: 38,300,458	D520G	probably benign	Het
Papln	C	T	12: 83,780,236	P712S	probably benign	Het
Pcbd2	T	A	13: 55,733,033	I34N	probably damaging	Het
Pkd1l3	T	A	8: 109,647,573	C29*	probably null	Het
Pou5f1	G	A	17: 35,510,002	V114M	probably benign	Het
Prpf4b	C	A	13: 34,884,231		probably benign	Het
Prr23a1	C	T	9: 98,842,656	P24S	probably damaging	Het
Ptch1	T	A	13: 63,545,245	M65L	probably benign	Het
Rc3h2	A	T	2: 37,399,624	I392K	possibly damaging	Het
Reck	G	T	4: 43,943,195	D916Y	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Ryr1	G	T	7: 29,090,150	T1513K	probably damaging	Het
Sacs	A	G	14: 61,173,441	D55G	possibly damaging	Het
Scn9a	A	G	2: 66,568,183	S28P	probably benign	Het
Scrn3	A	G	2: 73,329,852	M280V	probably damaging	Het
Snx29	C	T	16: 11,511,034	T559I	possibly damaging	Het
Spn	C	T	7: 127,136,241	E109K	probably damaging	Het
Sra1	C	T	18: 36,675,068	R369H	probably benign	Het
Srsf11	C	T	3: 158,019,345	A64T	probably damaging	Het
Stk17b	A	G	1: 53,776,605	S12P	probably benign	Het
Sult1d1	C	A	5: 87,559,802	G153V	probably damaging	Het
Sycp2	A	T	2: 178,350,138		probably null	Het
Tgfb3	T	C	12: 86,069,769	E165G	possibly damaging	Het
Tns2	C	A	15: 102,107,506	H160N	probably benign	Het
Ubn1	T	A	16: 5,077,224	C711*	probably null	Het
Usp13	A	T	3: 32,901,986	D469V	probably damaging	Het
Vmn1r231	A	T	17: 20,890,118	H178Q	possibly damaging	Het
Vwa1	A	G	4: 155,772,793	S183P	probably damaging	Het
Xpo7	A	G	14: 70,690,991	I424T	probably benign	Het
Zfp109	A	G	7: 24,236,616		probably null	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCAACCCACACTGACTGAG -3'
(R):5'- TTTTAGCAGCATCCGAGCC -3'

Sequencing Primer
(F):5'- TGACTGAGACCCCAGCAAG -3'
(R):5'- GCATCCGAGCCAGCAATG -3'

Posted On

2014-09-18