Incidental Mutation 'R2105:Spn'
ID 230873
Institutional Source Beutler Lab
Gene Symbol Spn
Ensembl Gene ENSMUSG00000051457
Gene Name sialophorin
Synonyms A630014B01Rik, Ly48, Galgp, 3E8 antigen, Ly-48, Cd43, leukosialin
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 126731404-126736995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126735413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 109 (E109K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049931] [ENSMUST00000143713]
AlphaFold P15702
Predicted Effect probably benign
Transcript: ENSMUST00000049931
AA Change: E365K

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049534
Gene: ENSMUSG00000051457
AA Change: E365K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 205 241 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143713
AA Change: E365K

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122787
Gene: ENSMUSG00000051457
AA Change: E365K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 205 241 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205483
AA Change: E109K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major sialoglycoprotein found on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. It may be part of a physiologic ligand-receptor complex involved in T-cell activation. During T-cell activation, this protein is actively removed from the T-cell-APC (antigen-presenting cell) contact site, suggesting a negative regulatory role in adaptive immune response. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show increased T cell proliferation in response to various stimulation agents and natural antigens, enhanced homotypic adhesion, transient resistance to melanoma growth and metastasis, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Spn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Spn APN 7 126,735,692 (GRCm39) missense probably damaging 0.96
IGL02956:Spn APN 7 126,736,432 (GRCm39) missense probably damaging 1.00
IGL03352:Spn APN 7 126,736,178 (GRCm39) missense probably benign 0.00
PIT4520001:Spn UTSW 7 126,735,611 (GRCm39) missense probably damaging 1.00
R0055:Spn UTSW 7 126,735,494 (GRCm39) missense possibly damaging 0.94
R0624:Spn UTSW 7 126,735,380 (GRCm39) missense possibly damaging 0.52
R0905:Spn UTSW 7 126,735,503 (GRCm39) missense probably damaging 0.96
R1256:Spn UTSW 7 126,735,445 (GRCm39) missense possibly damaging 0.55
R2055:Spn UTSW 7 126,736,388 (GRCm39) missense probably damaging 0.96
R2084:Spn UTSW 7 126,736,210 (GRCm39) missense probably benign 0.00
R2251:Spn UTSW 7 126,736,331 (GRCm39) missense probably benign 0.19
R5031:Spn UTSW 7 126,736,402 (GRCm39) missense probably benign
R6146:Spn UTSW 7 126,735,479 (GRCm39) missense possibly damaging 0.72
R6362:Spn UTSW 7 126,735,895 (GRCm39) missense possibly damaging 0.55
R7353:Spn UTSW 7 126,736,178 (GRCm39) missense probably benign 0.00
R7583:Spn UTSW 7 126,736,234 (GRCm39) missense probably damaging 0.99
R8507:Spn UTSW 7 126,735,728 (GRCm39) missense probably damaging 0.99
R9721:Spn UTSW 7 126,735,437 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAATTGGTTCCAAAGAAAGCAC -3'
(R):5'- CTGATGAAGAGGCCACAACC -3'

Sequencing Primer
(F):5'- TGGTCCACAAATATTCACAAATGCAG -3'
(R):5'- CAACCACATCAGGGGCAGG -3'
Posted On 2014-09-18