Incidental Mutation 'R2105:Pkd1l3'
ID 230880
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Name polycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110340828-110399305 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 110374205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 29 (C29*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
AlphaFold Q2EG98
Predicted Effect probably null
Transcript: ENSMUST00000057344
AA Change: C1423*
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: C1423*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109242
AA Change: C1433*
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: C1433*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212537
AA Change: C1423*
Predicted Effect probably null
Transcript: ENSMUST00000212545
AA Change: C29*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213034
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 110,356,869 (GRCm39) missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 110,365,338 (GRCm39) missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 110,388,873 (GRCm39) missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 110,350,403 (GRCm39) missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 110,350,153 (GRCm39) missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 110,394,157 (GRCm39) critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 110,361,934 (GRCm39) missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 110,375,134 (GRCm39) critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 110,356,798 (GRCm39) missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 110,357,908 (GRCm39) critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 110,361,933 (GRCm39) missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 110,387,438 (GRCm39) missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 110,358,010 (GRCm39) missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 110,362,012 (GRCm39) missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 110,392,217 (GRCm39) missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 110,395,924 (GRCm39) missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 110,365,296 (GRCm39) missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 110,357,977 (GRCm39) missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 110,387,434 (GRCm39) missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 110,365,310 (GRCm39) missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 110,357,708 (GRCm39) missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02358:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02369:Pkd1l3 APN 8 110,342,977 (GRCm39) missense unknown
IGL02481:Pkd1l3 APN 8 110,341,414 (GRCm39) missense unknown
IGL02505:Pkd1l3 APN 8 110,359,848 (GRCm39) missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 110,374,132 (GRCm39) missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 110,367,522 (GRCm39) nonsense probably null
IGL02715:Pkd1l3 APN 8 110,353,458 (GRCm39) missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 110,388,736 (GRCm39) splice site probably benign
IGL03059:Pkd1l3 APN 8 110,374,999 (GRCm39) missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 110,382,165 (GRCm39) nonsense probably null
IGL03206:Pkd1l3 APN 8 110,350,345 (GRCm39) missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 110,388,738 (GRCm39) splice site probably benign
BB006:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 110,387,433 (GRCm39) missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 110,391,131 (GRCm39) missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 110,355,265 (GRCm39) splice site probably benign
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0255:Pkd1l3 UTSW 8 110,365,386 (GRCm39) missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 110,373,131 (GRCm39) splice site probably null
R0311:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0311:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0441:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0465:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0466:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0488:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0515:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 110,348,340 (GRCm39) missense unknown
R1464:Pkd1l3 UTSW 8 110,363,059 (GRCm39) splice site probably benign
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 110,367,402 (GRCm39) missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1574:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1599:Pkd1l3 UTSW 8 110,363,016 (GRCm39) missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 110,350,450 (GRCm39) missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 110,359,237 (GRCm39) missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 110,375,038 (GRCm39) missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 110,350,831 (GRCm39) missense possibly damaging 0.92
R2185:Pkd1l3 UTSW 8 110,359,827 (GRCm39) missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 110,347,156 (GRCm39) missense unknown
R2260:Pkd1l3 UTSW 8 110,350,268 (GRCm39) missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 110,355,341 (GRCm39) missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R2435:Pkd1l3 UTSW 8 110,377,334 (GRCm39) missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 110,350,447 (GRCm39) missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 110,350,622 (GRCm39) missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 110,394,268 (GRCm39) splice site probably benign
R3755:Pkd1l3 UTSW 8 110,359,171 (GRCm39) missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 110,362,949 (GRCm39) missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 110,373,511 (GRCm39) missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 110,350,751 (GRCm39) missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 110,359,345 (GRCm39) splice site probably null
R4893:Pkd1l3 UTSW 8 110,365,026 (GRCm39) missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 110,367,475 (GRCm39) missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 110,392,268 (GRCm39) missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 110,349,787 (GRCm39) missense unknown
R5207:Pkd1l3 UTSW 8 110,359,823 (GRCm39) missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 110,367,424 (GRCm39) missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 110,393,684 (GRCm39) missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 110,382,152 (GRCm39) missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 110,356,842 (GRCm39) missense probably benign
R5623:Pkd1l3 UTSW 8 110,350,351 (GRCm39) missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 110,353,468 (GRCm39) missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 110,349,811 (GRCm39) missense unknown
R6330:Pkd1l3 UTSW 8 110,373,541 (GRCm39) missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 110,358,016 (GRCm39) missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 110,350,595 (GRCm39) missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 110,349,844 (GRCm39) missense unknown
R6480:Pkd1l3 UTSW 8 110,365,019 (GRCm39) nonsense probably null
R6519:Pkd1l3 UTSW 8 110,355,404 (GRCm39) missense probably benign
R6654:Pkd1l3 UTSW 8 110,350,915 (GRCm39) missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 110,341,401 (GRCm39) missense unknown
R6733:Pkd1l3 UTSW 8 110,375,126 (GRCm39) splice site probably null
R6753:Pkd1l3 UTSW 8 110,351,081 (GRCm39) missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 110,353,446 (GRCm39) missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 110,341,246 (GRCm39) missense unknown
R6975:Pkd1l3 UTSW 8 110,387,539 (GRCm39) missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7018:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7083:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7139:Pkd1l3 UTSW 8 110,362,972 (GRCm39) missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7235:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7238:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7252:Pkd1l3 UTSW 8 110,387,330 (GRCm39) missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7309:Pkd1l3 UTSW 8 110,374,893 (GRCm39) splice site probably null
R7362:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7462:Pkd1l3 UTSW 8 110,355,409 (GRCm39) missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 110,365,008 (GRCm39) missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 110,359,947 (GRCm39) missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7516:Pkd1l3 UTSW 8 110,361,861 (GRCm39) missense probably damaging 1.00
R7553:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7559:Pkd1l3 UTSW 8 110,351,072 (GRCm39) missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 110,399,217 (GRCm39) missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 110,365,049 (GRCm39) missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 110,341,204 (GRCm39) missense unknown
R7749:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7751:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7755:Pkd1l3 UTSW 8 110,356,798 (GRCm39) missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7831:Pkd1l3 UTSW 8 110,357,990 (GRCm39) missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7849:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R7917:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7929:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7952:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8054:Pkd1l3 UTSW 8 110,373,008 (GRCm39) missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8099:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8276:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R8352:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8376:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R8377:Pkd1l3 UTSW 8 110,361,982 (GRCm39) missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 110,360,022 (GRCm39) missense possibly damaging 0.85
R8530:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8539:Pkd1l3 UTSW 8 110,362,919 (GRCm39) missense probably damaging 1.00
R8546:Pkd1l3 UTSW 8 110,393,615 (GRCm39) missense possibly damaging 0.52
R8558:Pkd1l3 UTSW 8 110,362,012 (GRCm39) missense probably damaging 1.00
R8719:Pkd1l3 UTSW 8 110,341,255 (GRCm39) missense unknown
R8769:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8797:Pkd1l3 UTSW 8 110,374,946 (GRCm39) missense probably benign 0.15
R8840:Pkd1l3 UTSW 8 110,349,842 (GRCm39) missense unknown
R8846:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8874:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8893:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8956:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8963:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8968:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R9035:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9054:Pkd1l3 UTSW 8 110,392,304 (GRCm39) missense probably benign 0.08
R9058:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9119:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9134:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9138:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9158:Pkd1l3 UTSW 8 110,394,207 (GRCm39) nonsense probably null
R9180:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9181:Pkd1l3 UTSW 8 110,375,318 (GRCm39) missense probably damaging 0.98
R9218:Pkd1l3 UTSW 8 110,382,128 (GRCm39) nonsense probably null
R9249:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9269:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9338:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9383:Pkd1l3 UTSW 8 110,350,601 (GRCm39) small deletion probably benign
R9396:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9423:Pkd1l3 UTSW 8 110,350,312 (GRCm39) missense possibly damaging 0.53
R9514:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9515:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9567:Pkd1l3 UTSW 8 110,394,173 (GRCm39) missense probably damaging 0.99
R9668:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9684:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9748:Pkd1l3 UTSW 8 110,373,555 (GRCm39) missense probably benign 0.00
R9778:Pkd1l3 UTSW 8 110,357,937 (GRCm39) missense probably benign 0.00
RF016:Pkd1l3 UTSW 8 110,350,174 (GRCm39) missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
X0026:Pkd1l3 UTSW 8 110,341,185 (GRCm39) missense probably null
Z1176:Pkd1l3 UTSW 8 110,349,874 (GRCm39) missense unknown
Z31818:Pkd1l3 UTSW 8 110,395,924 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATCTGTAATTGTGCCCAG -3'
(R):5'- CTACCAGCTCAAGGTTGAAGGC -3'

Sequencing Primer
(F):5'- CCAGGGCTGAGCTAATGC -3'
(R):5'- CCAGCTCAAGGTTGAAGGCTAATAC -3'
Posted On 2014-09-18