Incidental Mutation 'R2105:Myocd'
ID 230887
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Name myocardin
Synonyms Srfcp
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 65067387-65160815 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 65109484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 96 (Q96*)
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
AlphaFold Q8VIM5
Predicted Effect probably benign
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102635
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: Q96*

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108695
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: Q96*

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65,071,770 (GRCm39) critical splice acceptor site probably null
IGL00481:Myocd APN 11 65,077,980 (GRCm39) missense probably damaging 0.99
IGL00857:Myocd APN 11 65,069,662 (GRCm39) missense possibly damaging 0.93
IGL01012:Myocd APN 11 65,075,451 (GRCm39) missense possibly damaging 0.51
IGL01570:Myocd APN 11 65,091,633 (GRCm39) missense probably benign 0.00
IGL01865:Myocd APN 11 65,091,723 (GRCm39) missense probably benign 0.30
IGL01938:Myocd APN 11 65,077,914 (GRCm39) missense probably damaging 1.00
IGL02324:Myocd APN 11 65,069,484 (GRCm39) missense probably benign 0.01
IGL02598:Myocd APN 11 65,074,296 (GRCm39) missense probably benign 0.31
IGL02886:Myocd APN 11 65,069,569 (GRCm39) missense probably damaging 0.99
IGL03008:Myocd APN 11 65,078,392 (GRCm39) missense probably damaging 0.98
IGL03034:Myocd APN 11 65,109,511 (GRCm39) missense probably benign 0.00
harvey UTSW 11 65,069,856 (GRCm39) splice site probably null
irma UTSW 11 65,087,220 (GRCm39) missense probably benign 0.02
myra UTSW 11 65,069,685 (GRCm39) missense probably benign 0.10
Nate UTSW 11 65,123,914 (GRCm39) splice site probably null
R0838_Myocd_053 UTSW 11 65,069,758 (GRCm39) missense probably benign 0.00
R0078:Myocd UTSW 11 65,078,290 (GRCm39) missense possibly damaging 0.96
R0097:Myocd UTSW 11 65,069,840 (GRCm39) missense possibly damaging 0.67
R0097:Myocd UTSW 11 65,069,840 (GRCm39) missense possibly damaging 0.67
R0234:Myocd UTSW 11 65,078,066 (GRCm39) missense probably benign 0.01
R0234:Myocd UTSW 11 65,078,066 (GRCm39) missense probably benign 0.01
R0453:Myocd UTSW 11 65,087,051 (GRCm39) missense probably damaging 1.00
R0523:Myocd UTSW 11 65,071,728 (GRCm39) missense probably damaging 1.00
R0838:Myocd UTSW 11 65,069,758 (GRCm39) missense probably benign 0.00
R0899:Myocd UTSW 11 65,086,018 (GRCm39) missense possibly damaging 0.50
R1167:Myocd UTSW 11 65,087,203 (GRCm39) missense possibly damaging 0.77
R1472:Myocd UTSW 11 65,078,330 (GRCm39) missense probably benign 0.01
R1508:Myocd UTSW 11 65,075,342 (GRCm39) missense probably damaging 0.98
R1620:Myocd UTSW 11 65,087,220 (GRCm39) missense probably benign 0.02
R1630:Myocd UTSW 11 65,087,220 (GRCm39) missense probably benign 0.02
R1731:Myocd UTSW 11 65,091,714 (GRCm39) missense probably benign 0.30
R1740:Myocd UTSW 11 65,109,347 (GRCm39) splice site probably benign
R1769:Myocd UTSW 11 65,069,527 (GRCm39) missense probably benign 0.01
R1823:Myocd UTSW 11 65,069,496 (GRCm39) missense probably benign 0.00
R1968:Myocd UTSW 11 65,091,733 (GRCm39) missense probably damaging 1.00
R1997:Myocd UTSW 11 65,095,147 (GRCm39) nonsense probably null
R2018:Myocd UTSW 11 65,077,854 (GRCm39) missense probably damaging 1.00
R2314:Myocd UTSW 11 65,091,633 (GRCm39) missense probably damaging 1.00
R4330:Myocd UTSW 11 65,114,590 (GRCm39) missense probably benign 0.12
R4331:Myocd UTSW 11 65,114,590 (GRCm39) missense probably benign 0.12
R4603:Myocd UTSW 11 65,078,571 (GRCm39) missense possibly damaging 0.82
R4619:Myocd UTSW 11 65,069,254 (GRCm39) utr 3 prime probably benign
R4631:Myocd UTSW 11 65,069,685 (GRCm39) missense probably benign 0.10
R4865:Myocd UTSW 11 65,069,856 (GRCm39) splice site probably null
R4974:Myocd UTSW 11 65,074,299 (GRCm39) missense possibly damaging 0.78
R4976:Myocd UTSW 11 65,112,876 (GRCm39) missense probably benign 0.00
R5478:Myocd UTSW 11 65,123,914 (GRCm39) splice site probably null
R5499:Myocd UTSW 11 65,069,575 (GRCm39) missense possibly damaging 0.62
R6052:Myocd UTSW 11 65,087,082 (GRCm39) missense probably damaging 1.00
R6356:Myocd UTSW 11 65,109,396 (GRCm39) splice site probably null
R7144:Myocd UTSW 11 65,109,474 (GRCm39) missense probably damaging 1.00
R7261:Myocd UTSW 11 65,078,422 (GRCm39) missense probably damaging 0.98
R7354:Myocd UTSW 11 65,078,319 (GRCm39) missense probably benign 0.00
R7461:Myocd UTSW 11 65,109,429 (GRCm39) missense probably damaging 1.00
R7613:Myocd UTSW 11 65,109,429 (GRCm39) missense probably damaging 1.00
R7718:Myocd UTSW 11 65,109,452 (GRCm39) missense probably damaging 1.00
R7956:Myocd UTSW 11 65,160,494 (GRCm39) missense possibly damaging 0.50
R8345:Myocd UTSW 11 65,077,958 (GRCm39) nonsense probably null
R8975:Myocd UTSW 11 65,069,287 (GRCm39) missense probably damaging 1.00
R9051:Myocd UTSW 11 65,077,795 (GRCm39) missense probably benign
R9400:Myocd UTSW 11 65,086,934 (GRCm39) missense probably benign 0.00
R9469:Myocd UTSW 11 65,087,220 (GRCm39) missense probably benign 0.02
R9565:Myocd UTSW 11 65,078,209 (GRCm39) missense probably damaging 1.00
R9567:Myocd UTSW 11 65,078,410 (GRCm39) missense probably damaging 1.00
R9585:Myocd UTSW 11 65,095,192 (GRCm39) missense probably damaging 1.00
R9710:Myocd UTSW 11 65,087,167 (GRCm39) missense probably damaging 1.00
R9768:Myocd UTSW 11 65,078,217 (GRCm39) missense probably damaging 1.00
X0057:Myocd UTSW 11 65,074,271 (GRCm39) missense possibly damaging 0.87
Z1186:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1187:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1188:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1189:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1190:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1191:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Z1192:Myocd UTSW 11 65,075,418 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTCAGAACAAAATCCCTGG -3'
(R):5'- CCTGTGAAGTGATGATGCTCAC -3'

Sequencing Primer
(F):5'- TGGATTGCCAGAGCTGC -3'
(R):5'- GTGTTTTCTAACCAGCAGC -3'
Posted On 2014-09-18