Mutagenetix > Incidental Mutation

Incidental Mutation 'R2105:Kansl1'

230895

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

040109-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2105 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 104335559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 924 (I924S)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977] [ENSMUST00000106992]

AlphaFold

Q80TG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000018556
AA Change: I924S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: I924S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106971
AA Change: I987S

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: I987S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106972
AA Change: I987S

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: I987S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106977
AA Change: I924S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: I924S

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106992

SMART Domains

Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

Domain	Start	End	E-Value	Type
low complexity region	69	81	N/A	INTRINSIC
low complexity region	105	154	N/A	INTRINSIC
Pfam:Tubulin-binding	174	205	6.1e-19	PFAM
Pfam:Tubulin-binding	206	236	1.5e-21	PFAM
Pfam:Tubulin-binding	237	267	6.9e-20	PFAM
Pfam:Tubulin-binding	268	299	4.7e-19	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,673,500	P1189L	probably benign	Het
Acbd4	G	A	11: 103,104,439	D57N	probably damaging	Het
Acot4	A	T	12: 84,038,742	M78L	probably damaging	Het
Ago1	A	T	4: 126,461,788	M76K	probably benign	Het
Agrn	G	T	4: 156,177,299	Y511*	probably null	Het
Arhgef15	A	T	11: 68,947,681		probably null	Het
Atp1a3	A	T	7: 24,989,853	M594K	probably damaging	Het
Atp4a	G	A	7: 30,720,368		probably null	Het
Bckdk	T	A	7: 127,907,317	I272N	probably damaging	Het
Bod1l	A	G	5: 41,832,279	V367A	probably benign	Het
C1galt1c1	T	C	X: 38,631,268	M284V	possibly damaging	Het
Cenpk	T	A	13: 104,229,597	C4*	probably null	Het
Cfap53	T	C	18: 74,283,223	V9A	possibly damaging	Het
Chil3	T	C	3: 106,160,478	I124V	possibly damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Cyp2c67	T	C	19: 39,626,237	Y282C	probably benign	Het
D5Ertd579e	C	T	5: 36,613,449	A1201T	probably benign	Het
Dock4	A	G	12: 40,692,989	H381R	probably benign	Het
Drc1	C	T	5: 30,356,441	S447F	probably benign	Het
Fam83g	G	T	11: 61,703,458	R606L	probably benign	Het
Fmnl1	A	C	11: 103,194,692	S688R	probably benign	Het
Fryl	C	T	5: 73,122,299	V219I	probably benign	Het
Gm13101	A	T	4: 143,965,820	Y204N	probably benign	Het
Golgb1	T	A	16: 36,914,664	N1424K	probably benign	Het
Gpr39	T	C	1: 125,677,884	V183A	possibly damaging	Het
H2-T22	A	T	17: 36,040,517	Y274N	probably benign	Het
Hif1a	T	A	12: 73,937,745	Y313N	probably damaging	Het
Hip1r	T	A	5: 124,000,204	M787K	probably damaging	Het
Hipk3	T	C	2: 104,439,392	E484G	probably damaging	Het
Hsh2d	T	A	8: 72,200,646	F291I	probably benign	Het
Ino80	T	C	2: 119,431,929	E692G	probably null	Het
Itgam	T	A	7: 128,081,712	V271D	probably damaging	Het
Kcnq2	A	G	2: 181,081,352	C628R	probably benign	Het
Krt78	A	C	15: 101,947,414	V654G	possibly damaging	Het
Lrit2	A	G	14: 37,071,956	T326A	probably damaging	Het
Ltk	T	C	2: 119,752,088	E710G	probably damaging	Het
Lysmd1	T	C	3: 95,134,974	L53S	probably damaging	Het
Mc4r	T	C	18: 66,859,598	Y148C	probably damaging	Het
Mfn2	G	A	4: 147,888,705	Q172*	probably null	Het
Mknk2	A	G	10: 80,668,601	L242P	possibly damaging	Het
Mrpl45	A	T	11: 97,325,747	H167L	probably benign	Het
Myc	T	C	15: 61,988,102	V208A	probably damaging	Het
Myh7b	A	G	2: 155,629,457	E1175G	probably benign	Het
Myo18a	A	T	11: 77,850,234	M1456L	probably benign	Het
Myocd	G	A	11: 65,218,658	Q96*	probably null	Het
Nckap5	T	A	1: 126,026,518	I766F	probably damaging	Het
Ndst1	T	C	18: 60,691,253	E784G	probably benign	Het
Nf1	A	T	11: 79,469,826	R1443S	possibly damaging	Het
Nhlrc3	A	G	3: 53,453,651	W228R	probably damaging	Het
Nup107	G	A	10: 117,773,320	T378I	probably damaging	Het
Olfr1033	C	T	2: 86,041,330	T5I	probably damaging	Het
Olfr1131	A	G	2: 87,628,939	T159A	probably benign	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr524	T	A	7: 140,202,743	D9V	probably benign	Het
Olfr607	T	A	7: 103,460,273		probably null	Het
Olfr98	A	T	17: 37,263,073	M197K	probably benign	Het
Otop1	A	G	5: 38,300,458	D520G	probably benign	Het
Papln	C	T	12: 83,780,236	P712S	probably benign	Het
Pcbd2	T	A	13: 55,733,033	I34N	probably damaging	Het
Pkd1l3	T	A	8: 109,647,573	C29*	probably null	Het
Pou5f1	G	A	17: 35,510,002	V114M	probably benign	Het
Prpf4b	C	A	13: 34,884,231		probably benign	Het
Prr23a1	C	T	9: 98,842,656	P24S	probably damaging	Het
Ptch1	T	A	13: 63,545,245	M65L	probably benign	Het
Rc3h2	A	T	2: 37,399,624	I392K	possibly damaging	Het
Reck	G	T	4: 43,943,195	D916Y	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Ryr1	G	T	7: 29,090,150	T1513K	probably damaging	Het
Sacs	A	G	14: 61,173,441	D55G	possibly damaging	Het
Scn9a	A	G	2: 66,568,183	S28P	probably benign	Het
Scrn3	A	G	2: 73,329,852	M280V	probably damaging	Het
Snx29	C	T	16: 11,511,034	T559I	possibly damaging	Het
Spn	C	T	7: 127,136,241	E109K	probably damaging	Het
Sra1	C	T	18: 36,675,068	R369H	probably benign	Het
Srsf11	C	T	3: 158,019,345	A64T	probably damaging	Het
Stk17b	A	G	1: 53,776,605	S12P	probably benign	Het
Sult1d1	C	A	5: 87,559,802	G153V	probably damaging	Het
Sycp2	A	T	2: 178,350,138		probably null	Het
Tgfb3	T	C	12: 86,069,769	E165G	possibly damaging	Het
Tns2	C	A	15: 102,107,506	H160N	probably benign	Het
Ubn1	T	A	16: 5,077,224	C711*	probably null	Het
Usp13	A	T	3: 32,901,986	D469V	probably damaging	Het
Vmn1r231	A	T	17: 20,890,118	H178Q	possibly damaging	Het
Vwa1	A	G	4: 155,772,793	S183P	probably damaging	Het
Xpo7	A	G	14: 70,690,991	I424T	probably benign	Het
Zfp109	A	G	7: 24,236,616		probably null	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign
R9033:Kansl1	UTSW	11	104357530	missense	probably benign	0.00
R9192:Kansl1	UTSW	11	104336316	missense	probably damaging	1.00
R9494:Kansl1	UTSW	11	104356740	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCTTTATCTTCGGCACATGC -3'
(R):5'- ACTGCTTTGGTGTAGATGCC -3'

Sequencing Primer
(F):5'- AAGGAGATACCCTCTCCT -3'
(R):5'- GCAGAAAAAGTGCTTACTCATTGGTG -3'

Posted On

2014-09-18