Incidental Mutation 'R2105:Dock4'
ID230896
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40692989 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 381 (H381R)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: H381R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: H381R

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: H381R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTGCGTGGCTAGTAAAACCTC -3'
(R):5'- CGGTCACCAGAGTTACTTCAC -3'

Sequencing Primer
(F):5'- GCGTGGCTAGTAAAACCTCATACG -3'
(R):5'- GGTCACCAGAGTTACTTCACTTCAG -3'
Posted On2014-09-18