Incidental Mutation 'R0189:Ino80'
ID23090
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0189 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119379679 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1377 (D1377V)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920]
Predicted Effect probably benign
Transcript: ENSMUST00000049920
AA Change: D1377V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D1377V

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Meta Mutation Damage Score 0.3725 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Gm1110 T A 9: 26,883,218 E504V probably null Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Olfr923 T A 9: 38,827,815 Y41* probably null Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Phf20 A G 2: 156,303,141 S890G probably benign Het
Plk2 C T 13: 110,399,463 T567M probably damaging Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rnf17 A G 14: 56,482,193 S967G probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
R7975:Ino80 UTSW 2 119456467 splice site probably null
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGAATGCTTCCCACTGAGCAG -3'
(R):5'- GCTTAGACAGGACAATGAGGCCAC -3'

Sequencing Primer
(F):5'- CAGTGGAGCAGGCTGAC -3'
(R):5'- gggaagaggaggaaagaggg -3'
Posted On2013-04-16