Mutagenetix > Incidental Mutation

Incidental Mutation 'R0189:Ino80'

23090

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

038450-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0189 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119379679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1377 (D1377V)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

AlphaFold

Q6ZPV2

Predicted Effect

probably benign
Transcript: ENSMUST00000049920
AA Change: D1377V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D1377V

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Meta Mutation Damage Score

0.3725

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,096,947	V207A	possibly damaging	Het
Abca9	A	T	11: 110,108,653	W1459R	probably damaging	Het
Abca9	A	T	11: 110,141,662		probably benign	Het
Adam25	T	A	8: 40,755,430	C578S	probably damaging	Het
Adam32	T	A	8: 24,922,337		probably null	Het
Add1	T	C	5: 34,616,648	V67A	probably benign	Het
Aggf1	A	T	13: 95,356,480		probably benign	Het
Ahcyl2	A	T	6: 29,891,243	I449F	probably benign	Het
Ak6	A	G	13: 100,655,142	Y31C	probably damaging	Het
Akap6	T	C	12: 53,141,254	V1817A	probably benign	Het
Arhgef17	G	T	7: 100,928,850	P964T	probably damaging	Het
Atxn7l3b	A	T	10: 112,928,580	L48Q	possibly damaging	Het
Bbs10	T	G	10: 111,301,065	S680A	probably damaging	Het
Bcl7c	G	A	7: 127,705,764	T164I	probably damaging	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Ccdc110	T	A	8: 45,935,082	D25E	probably damaging	Het
Ccdc83	T	A	7: 90,226,683	T327S	possibly damaging	Het
Coro1b	T	C	19: 4,153,251	Y364H	probably damaging	Het
Cstf3	A	G	2: 104,652,446	D313G	probably damaging	Het
Dlgap5	T	A	14: 47,412,975		probably null	Het
Dusp3	A	T	11: 101,981,721	I83N	probably damaging	Het
Eea1	A	T	10: 95,995,582	K178N	possibly damaging	Het
Efr3b	T	A	12: 3,982,925	D144V	probably damaging	Het
Gm1110	T	A	9: 26,883,218	E504V	probably null	Het
Got2	T	C	8: 95,888,253	H18R	probably benign	Het
Gprc5b	T	C	7: 118,983,633	M338V	probably benign	Het
Has2	A	T	15: 56,668,435	F295I	probably damaging	Het
Hcn3	T	C	3: 89,148,800	D519G	probably damaging	Het
Iqsec3	A	T	6: 121,413,562		probably benign	Het
Kif3c	T	A	12: 3,365,989	S3R	probably benign	Het
Krt17	A	G	11: 100,260,619	I116T	possibly damaging	Het
Lrba	T	C	3: 86,368,509	V1728A	probably damaging	Het
Map3k6	G	T	4: 133,246,941	V550L	possibly damaging	Het
Mcph1	T	C	8: 18,788,471	V803A	probably damaging	Het
Med13	A	G	11: 86,319,876	V480A	probably benign	Het
Msh5	T	C	17: 35,029,654	E772G	probably null	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Ndfip2	T	C	14: 105,304,740	L308P	probably damaging	Het
Ndufb10	T	C	17: 24,724,235	T34A	probably benign	Het
Nipal3	A	T	4: 135,468,518	I258N	possibly damaging	Het
Nup54	A	G	5: 92,422,564	V328A	probably damaging	Het
Olfr1410	T	C	1: 92,607,893	F19L	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr615	G	T	7: 103,561,082	V202F	probably benign	Het
Olfr763	T	A	10: 129,011,322	F12L	possibly damaging	Het
Olfr923	T	A	9: 38,827,815	Y41*	probably null	Het
Oprm1	T	C	10: 6,789,071	V66A	possibly damaging	Het
Peg12	G	A	7: 62,463,548	T267I	unknown	Het
Phf20	A	G	2: 156,303,141	S890G	probably benign	Het
Plk2	C	T	13: 110,399,463	T567M	probably damaging	Het
Pola2	A	T	19: 5,942,342		probably benign	Het
Ppp1r12b	A	G	1: 134,865,776		probably null	Het
Prickle1	A	T	15: 93,503,019	L528*	probably null	Het
Prpf6	T	A	2: 181,655,457	N903K	probably benign	Het
Ptprc	G	A	1: 138,082,715	A601V	probably benign	Het
Ranbp1	A	T	16: 18,241,743		probably null	Het
Rapgef6	C	T	11: 54,691,249	S1334L	probably benign	Het
Rgs2	T	C	1: 144,002,284		probably null	Het
Ripk2	A	T	4: 16,129,125		probably null	Het
Rnf17	A	G	14: 56,482,193	S967G	probably null	Het
Rock2	T	A	12: 16,959,516		probably benign	Het
Rpusd3	C	T	6: 113,415,553		probably null	Het
Scgb1b20	G	T	7: 33,373,510	V48L	probably benign	Het
Sec16a	T	A	2: 26,424,414		probably null	Het
Serpina5	T	A	12: 104,103,330	L267H	probably damaging	Het
Slc12a3	C	T	8: 94,356,358	H875Y	probably benign	Het
Slc45a4	A	G	15: 73,581,914	S745P	probably benign	Het
Sucla2	T	C	14: 73,592,648	V375A	probably damaging	Het
Sun2	C	A	15: 79,737,076	V213F	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	C	T	6: 7,562,424	R129C	probably damaging	Het
Taf6	T	C	5: 138,182,713	E202G	probably benign	Het
Tex21	T	A	12: 76,239,533	H64L	probably benign	Het
Tgs1	A	G	4: 3,593,620	S503G	probably benign	Het
Tmem184c	C	T	8: 77,597,812	V350I	possibly damaging	Het
Tnks1bp1	A	G	2: 85,070,929	S960G	possibly damaging	Het
Trbc2	T	C	6: 41,548,149		probably benign	Het
Tsta3	C	A	15: 75,926,978	D127Y	probably damaging	Het
Tubgcp2	A	T	7: 140,001,605		probably benign	Het
Vmn1r39	T	A	6: 66,805,197	T46S	probably benign	Het
Vmn1r61	T	C	7: 5,610,700	H205R	probably benign	Het
Zdhhc14	T	C	17: 5,725,264	S264P	possibly damaging	Het
Zfp101	T	A	17: 33,382,239	H181L	possibly damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGAATGCTTCCCACTGAGCAG -3'
(R):5'- GCTTAGACAGGACAATGAGGCCAC -3'

Sequencing Primer
(F):5'- CAGTGGAGCAGGCTGAC -3'
(R):5'- gggaagaggaggaaagaggg -3'

Posted On

2013-04-16