Incidental Mutation 'R2105:Cenpk'
ID230905
Institutional Source Beutler Lab
Gene Symbol Cenpk
Ensembl Gene ENSMUSG00000021714
Gene Namecentromere protein K
SynonymsB130045K24Rik, Solt, C530004N04Rik
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104228611-104252392 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104229597 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 4 (C4*)
Ref Sequence ENSEMBL: ENSMUSP00000022227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226] [ENSMUST00000022227] [ENSMUST00000070761] [ENSMUST00000224500] [ENSMUST00000224857] [ENSMUST00000225557]
Predicted Effect probably benign
Transcript: ENSMUST00000022226
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022227
AA Change: C4*
SMART Domains Protein: ENSMUSP00000022227
Gene: ENSMUSG00000021714
AA Change: C4*

DomainStartEndE-ValueType
Pfam:CENP-K 47 306 1.5e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070761
SMART Domains Protein: ENSMUSP00000070910
Gene: ENSMUSG00000021714

DomainStartEndE-ValueType
Pfam:CENP-K 1 231 1.1e-99 PFAM
low complexity region 237 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224179
Predicted Effect probably benign
Transcript: ENSMUST00000224500
Predicted Effect probably benign
Transcript: ENSMUST00000224857
Predicted Effect probably benign
Transcript: ENSMUST00000225557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225798
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Cenpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cenpk APN 13 104236234 unclassified probably benign
IGL02885:Cenpk APN 13 104249395 missense probably damaging 0.97
IGL03107:Cenpk APN 13 104242772 missense probably damaging 0.99
IGL03122:Cenpk APN 13 104242377 missense probably damaging 1.00
R0421:Cenpk UTSW 13 104242403 missense probably benign 0.36
R0423:Cenpk UTSW 13 104234225 missense probably benign 0.00
R1261:Cenpk UTSW 13 104230785 missense possibly damaging 0.90
R1262:Cenpk UTSW 13 104230785 missense possibly damaging 0.90
R2069:Cenpk UTSW 13 104236176 unclassified probably benign
R2183:Cenpk UTSW 13 104234163 missense probably damaging 0.99
R2509:Cenpk UTSW 13 104234167 splice site probably null
R4625:Cenpk UTSW 13 104249393 missense possibly damaging 0.86
R4755:Cenpk UTSW 13 104230871 missense probably benign 0.02
R4755:Cenpk UTSW 13 104249512 missense probably benign 0.06
R5217:Cenpk UTSW 13 104249409 missense probably damaging 1.00
R5865:Cenpk UTSW 13 104236194 makesense probably null
R6928:Cenpk UTSW 13 104228992 start gained probably benign
R7109:Cenpk UTSW 13 104230748 missense probably benign 0.44
R7444:Cenpk UTSW 13 104249517 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGCTCTATGTTTGACG -3'
(R):5'- GGCAAGGTTACTAGATGGCTG -3'

Sequencing Primer
(F):5'- GCATATAGTCTATGAGCCTTTGC -3'
(R):5'- AAGGTTACTAGATGGCTGTTGTAAAG -3'
Posted On2014-09-18