Incidental Mutation 'R2105:Sacs'
ID 230907
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Name sacsin
Synonyms E130115J16Rik
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2105 (G1)
Quality Score 217
Status Not validated
Chromosome 14
Chromosomal Location 61375906-61478144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61410890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 55 (D55G)
Ref Sequence ENSEMBL: ENSMUSP00000154300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000121091] [ENSMUST00000227570]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000089394
AA Change: D55G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279
AA Change: D55G

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
AA Change: D55G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279
AA Change: D55G

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: D55G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: D55G

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121091
AA Change: D52G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113925
Gene: ENSMUSG00000048279
AA Change: D52G

DomainStartEndE-ValueType
SCOP:d1lm8b_ 5 63 3e-3 SMART
Blast:UBQ 6 78 4e-31 BLAST
SCOP:d1byqa_ 84 199 4e-3 SMART
Blast:HATPase_c 113 208 2e-10 BLAST
low complexity region 605 620 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000227570
AA Change: D55G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61,429,084 (GRCm39) missense possibly damaging 0.64
IGL01839:Sacs APN 14 61,421,394 (GRCm39) intron probably benign
IGL02024:Sacs APN 14 61,427,127 (GRCm39) missense probably damaging 0.96
IGL02247:Sacs APN 14 61,429,984 (GRCm39) missense probably damaging 1.00
BB009:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
BB019:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
F6893:Sacs UTSW 14 61,450,425 (GRCm39) missense probably benign
IGL03052:Sacs UTSW 14 61,445,307 (GRCm39) missense probably damaging 0.99
R0090:Sacs UTSW 14 61,442,889 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0390:Sacs UTSW 14 61,443,089 (GRCm39) missense possibly damaging 0.92
R0479:Sacs UTSW 14 61,428,928 (GRCm39) missense probably damaging 0.99
R0556:Sacs UTSW 14 61,421,407 (GRCm39) missense probably damaging 0.99
R0673:Sacs UTSW 14 61,447,664 (GRCm39) missense possibly damaging 0.89
R0748:Sacs UTSW 14 61,446,714 (GRCm39) missense probably damaging 0.99
R0931:Sacs UTSW 14 61,440,944 (GRCm39) missense probably benign
R0972:Sacs UTSW 14 61,449,412 (GRCm39) nonsense probably null
R1281:Sacs UTSW 14 61,429,250 (GRCm39) missense probably benign 0.02
R1340:Sacs UTSW 14 61,441,958 (GRCm39) missense probably damaging 0.98
R1351:Sacs UTSW 14 61,440,210 (GRCm39) missense probably benign 0.00
R1499:Sacs UTSW 14 61,451,153 (GRCm39) missense possibly damaging 0.70
R1538:Sacs UTSW 14 61,447,508 (GRCm39) missense probably damaging 0.98
R1581:Sacs UTSW 14 61,451,128 (GRCm39) missense probably damaging 0.96
R1599:Sacs UTSW 14 61,441,087 (GRCm39) missense probably benign
R1631:Sacs UTSW 14 61,448,181 (GRCm39) nonsense probably null
R1635:Sacs UTSW 14 61,441,277 (GRCm39) missense probably damaging 0.98
R1655:Sacs UTSW 14 61,429,231 (GRCm39) missense probably benign
R1660:Sacs UTSW 14 61,446,458 (GRCm39) missense probably damaging 0.99
R1707:Sacs UTSW 14 61,447,211 (GRCm39) missense probably benign 0.01
R1733:Sacs UTSW 14 61,442,903 (GRCm39) missense probably damaging 1.00
R1772:Sacs UTSW 14 61,448,346 (GRCm39) missense probably damaging 1.00
R1976:Sacs UTSW 14 61,440,344 (GRCm39) missense probably benign
R2055:Sacs UTSW 14 61,451,498 (GRCm39) missense probably damaging 0.97
R2083:Sacs UTSW 14 61,443,955 (GRCm39) missense possibly damaging 0.69
R2091:Sacs UTSW 14 61,429,368 (GRCm39) missense possibly damaging 0.95
R2109:Sacs UTSW 14 61,410,902 (GRCm39) splice site probably null
R2117:Sacs UTSW 14 61,451,220 (GRCm39) missense probably benign 0.01
R2122:Sacs UTSW 14 61,449,765 (GRCm39) missense probably damaging 1.00
R2148:Sacs UTSW 14 61,410,827 (GRCm39) missense probably damaging 0.97
R2151:Sacs UTSW 14 61,447,089 (GRCm39) missense probably damaging 1.00
R2231:Sacs UTSW 14 61,443,378 (GRCm39) splice site probably null
R2248:Sacs UTSW 14 61,450,251 (GRCm39) missense probably damaging 1.00
R2271:Sacs UTSW 14 61,442,109 (GRCm39) missense probably benign 0.06
R2314:Sacs UTSW 14 61,445,208 (GRCm39) missense probably benign 0.17
R2436:Sacs UTSW 14 61,440,354 (GRCm39) missense possibly damaging 0.94
R2445:Sacs UTSW 14 61,442,655 (GRCm39) missense probably damaging 1.00
R2512:Sacs UTSW 14 61,440,529 (GRCm39) missense probably benign 0.00
R3434:Sacs UTSW 14 61,449,752 (GRCm39) missense probably damaging 1.00
R3785:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3786:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3796:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3798:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3872:Sacs UTSW 14 61,385,517 (GRCm39) missense probably benign 0.30
R3873:Sacs UTSW 14 61,429,735 (GRCm39) missense possibly damaging 0.64
R3892:Sacs UTSW 14 61,441,836 (GRCm39) missense probably damaging 0.98
R4184:Sacs UTSW 14 61,451,393 (GRCm39) missense probably damaging 0.97
R4204:Sacs UTSW 14 61,410,892 (GRCm39) missense possibly damaging 0.93
R4249:Sacs UTSW 14 61,440,906 (GRCm39) missense probably benign 0.02
R4256:Sacs UTSW 14 61,443,786 (GRCm39) missense probably damaging 1.00
R4370:Sacs UTSW 14 61,449,758 (GRCm39) missense probably damaging 1.00
R4445:Sacs UTSW 14 61,442,135 (GRCm39) missense probably benign 0.30
R4503:Sacs UTSW 14 61,445,052 (GRCm39) missense probably damaging 1.00
R4548:Sacs UTSW 14 61,429,387 (GRCm39) missense probably damaging 1.00
R4582:Sacs UTSW 14 61,429,147 (GRCm39) missense probably damaging 1.00
R4613:Sacs UTSW 14 61,449,246 (GRCm39) splice site probably null
R4639:Sacs UTSW 14 61,444,717 (GRCm39) missense probably benign 0.12
R4697:Sacs UTSW 14 61,450,196 (GRCm39) missense probably benign 0.19
R4706:Sacs UTSW 14 61,441,722 (GRCm39) missense probably damaging 1.00
R4717:Sacs UTSW 14 61,450,304 (GRCm39) missense probably damaging 1.00
R4777:Sacs UTSW 14 61,449,258 (GRCm39) missense probably damaging 1.00
R4888:Sacs UTSW 14 61,449,647 (GRCm39) missense probably damaging 1.00
R4913:Sacs UTSW 14 61,451,246 (GRCm39) missense probably benign 0.17
R4973:Sacs UTSW 14 61,450,571 (GRCm39) missense probably damaging 1.00
R4986:Sacs UTSW 14 61,450,492 (GRCm39) nonsense probably null
R5090:Sacs UTSW 14 61,442,702 (GRCm39) missense probably damaging 1.00
R5243:Sacs UTSW 14 61,443,406 (GRCm39) nonsense probably null
R5292:Sacs UTSW 14 61,449,432 (GRCm39) missense probably damaging 1.00
R5308:Sacs UTSW 14 61,429,849 (GRCm39) missense probably benign 0.21
R5337:Sacs UTSW 14 61,430,963 (GRCm39) intron probably benign
R5502:Sacs UTSW 14 61,443,549 (GRCm39) missense probably damaging 1.00
R5586:Sacs UTSW 14 61,443,890 (GRCm39) nonsense probably null
R5692:Sacs UTSW 14 61,445,288 (GRCm39) missense probably benign 0.00
R5725:Sacs UTSW 14 61,448,559 (GRCm39) missense probably damaging 1.00
R5854:Sacs UTSW 14 61,448,996 (GRCm39) missense probably damaging 1.00
R5959:Sacs UTSW 14 61,449,849 (GRCm39) missense probably damaging 0.99
R5960:Sacs UTSW 14 61,446,144 (GRCm39) missense probably benign 0.30
R5968:Sacs UTSW 14 61,427,078 (GRCm39) missense probably damaging 0.99
R5983:Sacs UTSW 14 61,442,648 (GRCm39) missense probably damaging 1.00
R5992:Sacs UTSW 14 61,442,992 (GRCm39) missense probably damaging 1.00
R6076:Sacs UTSW 14 61,441,985 (GRCm39) nonsense probably null
R6175:Sacs UTSW 14 61,450,275 (GRCm39) missense possibly damaging 0.82
R6347:Sacs UTSW 14 61,448,609 (GRCm39) missense probably damaging 1.00
R6357:Sacs UTSW 14 61,446,273 (GRCm39) missense possibly damaging 0.47
R6415:Sacs UTSW 14 61,442,808 (GRCm39) missense probably damaging 1.00
R6469:Sacs UTSW 14 61,428,697 (GRCm39) missense probably damaging 1.00
R6503:Sacs UTSW 14 61,448,810 (GRCm39) missense probably benign 0.00
R6523:Sacs UTSW 14 61,440,410 (GRCm39) missense probably damaging 0.99
R6615:Sacs UTSW 14 61,446,383 (GRCm39) missense probably benign 0.15
R6729:Sacs UTSW 14 61,447,967 (GRCm39) missense probably damaging 1.00
R6731:Sacs UTSW 14 61,418,149 (GRCm39) splice site probably null
R6797:Sacs UTSW 14 61,450,522 (GRCm39) missense probably damaging 1.00
R6852:Sacs UTSW 14 61,416,737 (GRCm39) missense possibly damaging 0.87
R6922:Sacs UTSW 14 61,448,874 (GRCm39) missense probably damaging 1.00
R7023:Sacs UTSW 14 61,446,264 (GRCm39) missense probably benign 0.04
R7047:Sacs UTSW 14 61,450,451 (GRCm39) missense probably damaging 1.00
R7051:Sacs UTSW 14 61,446,377 (GRCm39) missense probably benign 0.25
R7069:Sacs UTSW 14 61,449,945 (GRCm39) missense probably damaging 1.00
R7082:Sacs UTSW 14 61,447,966 (GRCm39) missense possibly damaging 0.94
R7108:Sacs UTSW 14 61,448,458 (GRCm39) nonsense probably null
R7122:Sacs UTSW 14 61,447,845 (GRCm39) missense probably damaging 1.00
R7194:Sacs UTSW 14 61,447,538 (GRCm39) missense possibly damaging 0.95
R7214:Sacs UTSW 14 61,429,241 (GRCm39) missense probably benign
R7221:Sacs UTSW 14 61,446,255 (GRCm39) missense probably damaging 0.99
R7274:Sacs UTSW 14 61,451,530 (GRCm39) missense possibly damaging 0.88
R7344:Sacs UTSW 14 61,444,893 (GRCm39) missense possibly damaging 0.81
R7440:Sacs UTSW 14 61,429,054 (GRCm39) missense probably benign 0.10
R7474:Sacs UTSW 14 61,448,627 (GRCm39) missense probably benign 0.04
R7512:Sacs UTSW 14 61,441,879 (GRCm39) missense probably benign 0.04
R7641:Sacs UTSW 14 61,440,320 (GRCm39) missense probably damaging 0.97
R7649:Sacs UTSW 14 61,440,677 (GRCm39) missense possibly damaging 0.53
R7703:Sacs UTSW 14 61,443,539 (GRCm39) missense possibly damaging 0.81
R7792:Sacs UTSW 14 61,447,222 (GRCm39) missense probably benign 0.00
R7805:Sacs UTSW 14 61,441,040 (GRCm39) missense not run
R7822:Sacs UTSW 14 61,429,652 (GRCm39) missense probably benign 0.03
R7882:Sacs UTSW 14 61,444,520 (GRCm39) missense probably benign 0.02
R7932:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
R8031:Sacs UTSW 14 61,441,640 (GRCm39) missense probably damaging 0.96
R8064:Sacs UTSW 14 61,429,624 (GRCm39) missense possibly damaging 0.92
R8083:Sacs UTSW 14 61,448,166 (GRCm39) missense possibly damaging 0.77
R8204:Sacs UTSW 14 61,450,397 (GRCm39) missense probably damaging 0.96
R8293:Sacs UTSW 14 61,428,548 (GRCm39) missense probably damaging 0.99
R8316:Sacs UTSW 14 61,427,068 (GRCm39) missense possibly damaging 0.84
R8393:Sacs UTSW 14 61,410,655 (GRCm39) start codon destroyed probably null 0.06
R8434:Sacs UTSW 14 61,450,636 (GRCm39) nonsense probably null
R8482:Sacs UTSW 14 61,440,404 (GRCm39) missense probably benign
R8497:Sacs UTSW 14 61,429,702 (GRCm39) missense probably benign 0.00
R8557:Sacs UTSW 14 61,444,725 (GRCm39) missense probably damaging 1.00
R8698:Sacs UTSW 14 61,450,802 (GRCm39) missense probably benign
R8840:Sacs UTSW 14 61,429,177 (GRCm39) missense probably benign 0.25
R8924:Sacs UTSW 14 61,448,702 (GRCm39) missense probably damaging 1.00
R8924:Sacs UTSW 14 61,429,895 (GRCm39) missense probably benign 0.22
R8941:Sacs UTSW 14 61,430,022 (GRCm39) missense probably benign 0.00
R9007:Sacs UTSW 14 61,445,185 (GRCm39) missense probably benign 0.04
R9008:Sacs UTSW 14 61,441,992 (GRCm39) missense probably benign 0.19
R9070:Sacs UTSW 14 61,447,751 (GRCm39) missense probably benign
R9147:Sacs UTSW 14 61,450,137 (GRCm39) missense possibly damaging 0.86
R9185:Sacs UTSW 14 61,444,115 (GRCm39) missense probably damaging 0.98
R9290:Sacs UTSW 14 61,421,499 (GRCm39) missense probably benign 0.17
R9294:Sacs UTSW 14 61,477,768 (GRCm39) missense possibly damaging 0.84
R9339:Sacs UTSW 14 61,443,309 (GRCm39) missense probably benign 0.00
R9341:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9343:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9370:Sacs UTSW 14 61,441,080 (GRCm39) missense probably damaging 1.00
R9433:Sacs UTSW 14 61,443,997 (GRCm39) missense probably damaging 1.00
R9460:Sacs UTSW 14 61,441,611 (GRCm39) missense probably benign 0.34
R9548:Sacs UTSW 14 61,440,692 (GRCm39) missense probably benign 0.02
R9564:Sacs UTSW 14 61,449,046 (GRCm39) missense probably damaging 1.00
R9644:Sacs UTSW 14 61,443,428 (GRCm39) missense probably benign 0.00
R9683:Sacs UTSW 14 61,450,881 (GRCm39) missense possibly damaging 0.95
R9706:Sacs UTSW 14 61,445,822 (GRCm39) nonsense probably null
X0067:Sacs UTSW 14 61,445,468 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,450,649 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,448,279 (GRCm39) nonsense probably null
Z1177:Sacs UTSW 14 61,445,430 (GRCm39) missense possibly damaging 0.93
Z1177:Sacs UTSW 14 61,429,000 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GTCTAAGAAGGCGTGGCTAC -3'
(R):5'- GGCAGTTAAGATTCACAAATGTGG -3'

Sequencing Primer
(F):5'- ACATGGCCCTTTGCAGC -3'
(R):5'- CACAAATGTGGAAATTGTAAGTGC -3'
Posted On 2014-09-18