Incidental Mutation 'R2105:Xpo7'
ID 230908
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Name exportin 7
Synonyms 4930506C02Rik, Ranbp16
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70899566-71004075 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70928431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 424 (I424T)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
AlphaFold Q9EPK7
Predicted Effect probably benign
Transcript: ENSMUST00000022696
AA Change: I423T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: I423T

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167242
AA Change: I423T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: I423T

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226448
AA Change: I423T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably benign
Transcript: ENSMUST00000228346
AA Change: I424T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70,909,098 (GRCm39) missense probably benign 0.32
IGL01066:Xpo7 APN 14 70,939,195 (GRCm39) missense probably benign 0.01
IGL01610:Xpo7 APN 14 70,940,670 (GRCm39) missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70,922,995 (GRCm39) missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70,903,475 (GRCm39) missense probably benign 0.03
IGL02647:Xpo7 APN 14 70,922,905 (GRCm39) missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70,918,702 (GRCm39) missense probably benign 0.09
IGL03245:Xpo7 APN 14 70,925,734 (GRCm39) missense probably damaging 1.00
BB010:Xpo7 UTSW 14 70,944,788 (GRCm39) missense probably benign 0.05
BB020:Xpo7 UTSW 14 70,944,788 (GRCm39) missense probably benign 0.05
G1patch:Xpo7 UTSW 14 70,914,253 (GRCm39) missense probably damaging 1.00
PIT4687001:Xpo7 UTSW 14 70,904,589 (GRCm39) missense probably benign 0.22
R0893:Xpo7 UTSW 14 70,903,537 (GRCm39) splice site probably benign
R1222:Xpo7 UTSW 14 70,904,524 (GRCm39) missense possibly damaging 0.55
R1474:Xpo7 UTSW 14 70,936,473 (GRCm39) missense probably benign 0.00
R1509:Xpo7 UTSW 14 70,915,582 (GRCm39) missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70,931,431 (GRCm39) missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70,933,064 (GRCm39) missense probably benign 0.20
R2369:Xpo7 UTSW 14 70,925,171 (GRCm39) nonsense probably null
R2937:Xpo7 UTSW 14 70,909,130 (GRCm39) missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70,909,130 (GRCm39) missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70,904,577 (GRCm39) missense probably benign 0.38
R2940:Xpo7 UTSW 14 70,904,576 (GRCm39) missense probably damaging 1.00
R3001:Xpo7 UTSW 14 70,930,085 (GRCm39) splice site probably benign
R4436:Xpo7 UTSW 14 70,906,869 (GRCm39) missense probably damaging 1.00
R4529:Xpo7 UTSW 14 70,906,188 (GRCm39) missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70,914,256 (GRCm39) critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70,914,256 (GRCm39) critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70,908,069 (GRCm39) missense probably benign 0.16
R5007:Xpo7 UTSW 14 70,925,704 (GRCm39) missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70,921,171 (GRCm39) missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70,921,117 (GRCm39) missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70,909,090 (GRCm39) nonsense probably null
R5533:Xpo7 UTSW 14 70,931,407 (GRCm39) missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70,920,286 (GRCm39) missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70,933,103 (GRCm39) missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70,921,159 (GRCm39) missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70,919,778 (GRCm39) missense probably null 0.99
R6085:Xpo7 UTSW 14 70,934,051 (GRCm39) missense probably benign 0.38
R6180:Xpo7 UTSW 14 70,920,243 (GRCm39) missense probably benign 0.14
R6291:Xpo7 UTSW 14 70,942,130 (GRCm39) nonsense probably null
R6401:Xpo7 UTSW 14 70,919,787 (GRCm39) missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70,919,802 (GRCm39) missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70,914,253 (GRCm39) missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70,903,464 (GRCm39) missense probably benign 0.00
R6996:Xpo7 UTSW 14 70,906,888 (GRCm39) missense probably benign
R7020:Xpo7 UTSW 14 70,903,463 (GRCm39) missense probably benign 0.00
R7053:Xpo7 UTSW 14 70,922,298 (GRCm39) critical splice donor site probably null
R7061:Xpo7 UTSW 14 70,908,512 (GRCm39) missense probably benign 0.04
R7095:Xpo7 UTSW 14 70,942,146 (GRCm39) missense probably damaging 1.00
R7604:Xpo7 UTSW 14 70,909,110 (GRCm39) missense probably damaging 1.00
R7933:Xpo7 UTSW 14 70,944,788 (GRCm39) missense probably benign 0.05
R8044:Xpo7 UTSW 14 70,922,366 (GRCm39) missense probably benign 0.18
R8438:Xpo7 UTSW 14 70,940,672 (GRCm39) missense probably benign 0.02
R8495:Xpo7 UTSW 14 70,907,989 (GRCm39) critical splice donor site probably null
R8518:Xpo7 UTSW 14 70,944,837 (GRCm39) missense probably damaging 1.00
R9018:Xpo7 UTSW 14 70,944,864 (GRCm39) nonsense probably null
R9129:Xpo7 UTSW 14 70,909,113 (GRCm39) missense probably benign 0.00
R9385:Xpo7 UTSW 14 70,925,733 (GRCm39) missense probably damaging 1.00
R9567:Xpo7 UTSW 14 70,903,466 (GRCm39) missense probably benign 0.00
R9569:Xpo7 UTSW 14 70,906,140 (GRCm39) missense possibly damaging 0.80
R9610:Xpo7 UTSW 14 70,925,617 (GRCm39) missense probably benign 0.32
R9611:Xpo7 UTSW 14 70,925,617 (GRCm39) missense probably benign 0.32
X0062:Xpo7 UTSW 14 70,922,968 (GRCm39) missense probably damaging 1.00
Z1176:Xpo7 UTSW 14 70,930,150 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGGGTCCTATAAACAGTTCTCAC -3'
(R):5'- GTCTTAGCACTGGGAATTTGCC -3'

Sequencing Primer
(F):5'- CAGCTGTGAATGTTGATACAAAAG -3'
(R):5'- GGAATTTGCCCCAAATAGTGTGC -3'
Posted On 2014-09-18