Incidental Mutation 'R2105:Myc'
ID230910
Institutional Source Beutler Lab
Gene Symbol Myc
Ensembl Gene ENSMUSG00000022346
Gene Namemyelocytomatosis oncogene
SynonymsNird, Myc2, Niard, c-myc, bHLHe39
MMRRC Submission 040109-MU
Accession Numbers

VEGA: OTTMUSP00000048877; MGI: 97250

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location61985391-61990374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61988102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000130285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022971] [ENSMUST00000159327] [ENSMUST00000159338] [ENSMUST00000160009] [ENSMUST00000161976] [ENSMUST00000167731] [ENSMUST00000188482] [ENSMUST00000191178]
Predicted Effect probably damaging
Transcript: ENSMUST00000022971
AA Change: V209A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022971
Gene: ENSMUSG00000022346
AA Change: V209A

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 7e-118 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159327
AA Change: V194A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124758
Gene: ENSMUSG00000022346
AA Change: V194A

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159338
Predicted Effect probably damaging
Transcript: ENSMUST00000160009
AA Change: V194A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123852
Gene: ENSMUSG00000022346
AA Change: V194A

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161976
AA Change: V194A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123821
Gene: ENSMUSG00000022346
AA Change: V194A

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167731
AA Change: V208A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130285
Gene: ENSMUSG00000022346
AA Change: V208A

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.5e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188482
AA Change: V209A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140183
Gene: ENSMUSG00000022346
AA Change: V209A

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 1.5e-141 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191178
AA Change: V208A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141139
Gene: ENSMUSG00000022346
AA Change: V208A

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.9e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mutations affect growth and development of heart, pericardium, neural tube, vasculogenesis and erythropoeisis. Homozygous null mutants die by embryonic day 10.5. Heterozygotes have reduced body size and multiorgan hypoplasia; females have small litters. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(19) Gene trapped(4)          

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Myc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Myc APN 15 61989820 missense probably benign 0.03
IGL02372:Myc APN 15 61987858 missense probably damaging 1.00
IGL02400:Myc APN 15 61989911 unclassified probably benign
IGL02677:Myc APN 15 61989664 missense probably damaging 1.00
IGL02834:Myc APN 15 61987666 missense probably damaging 1.00
IGL03330:Myc APN 15 61988149 missense probably benign
PIT1430001:Myc UTSW 15 61987693 missense probably damaging 1.00
R1245:Myc UTSW 15 61987897 missense probably damaging 0.96
R4373:Myc UTSW 15 61989664 missense probably damaging 0.99
R6774:Myc UTSW 15 61988279 critical splice donor site probably null
R6813:Myc UTSW 15 61988152 missense probably damaging 1.00
R7371:Myc UTSW 15 61988182 missense probably damaging 0.97
R8376:Myc UTSW 15 61987546 missense possibly damaging 0.94
RF020:Myc UTSW 15 61985823 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCCAGGACTGTATGTGGAGC -3'
(R):5'- GCTTCCTACCCTGCTGTGAATG -3'

Sequencing Primer
(F):5'- TGGAGCGGTTTCTCAGCC -3'
(R):5'- TAGCTTACCAGAGTCGCTGCTG -3'
Posted On2014-09-18