Mutagenetix > Incidental Mutation

Incidental Mutation 'R2105:Tns2'

230913

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

040109-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2105 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 102107506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 160 (H160N)

Ref Sequence

ENSEMBL: ENSMUSP00000155624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]

AlphaFold

Q8CGB6

Predicted Effect

probably benign
Transcript: ENSMUST00000046144
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: H183N

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169627
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: H183N

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228958
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000229592
AA Change: H160N

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229908

Predicted Effect

probably benign
Transcript: ENSMUST00000230474
AA Change: H175N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,673,500	P1189L	probably benign	Het
Acbd4	G	A	11: 103,104,439	D57N	probably damaging	Het
Acot4	A	T	12: 84,038,742	M78L	probably damaging	Het
Ago1	A	T	4: 126,461,788	M76K	probably benign	Het
Agrn	G	T	4: 156,177,299	Y511*	probably null	Het
Arhgef15	A	T	11: 68,947,681		probably null	Het
Atp1a3	A	T	7: 24,989,853	M594K	probably damaging	Het
Atp4a	G	A	7: 30,720,368		probably null	Het
Bckdk	T	A	7: 127,907,317	I272N	probably damaging	Het
Bod1l	A	G	5: 41,832,279	V367A	probably benign	Het
C1galt1c1	T	C	X: 38,631,268	M284V	possibly damaging	Het
Cenpk	T	A	13: 104,229,597	C4*	probably null	Het
Cfap53	T	C	18: 74,283,223	V9A	possibly damaging	Het
Chil3	T	C	3: 106,160,478	I124V	possibly damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Cyp2c67	T	C	19: 39,626,237	Y282C	probably benign	Het
D5Ertd579e	C	T	5: 36,613,449	A1201T	probably benign	Het
Dock4	A	G	12: 40,692,989	H381R	probably benign	Het
Drc1	C	T	5: 30,356,441	S447F	probably benign	Het
Fam83g	G	T	11: 61,703,458	R606L	probably benign	Het
Fmnl1	A	C	11: 103,194,692	S688R	probably benign	Het
Fryl	C	T	5: 73,122,299	V219I	probably benign	Het
Gm13101	A	T	4: 143,965,820	Y204N	probably benign	Het
Golgb1	T	A	16: 36,914,664	N1424K	probably benign	Het
Gpr39	T	C	1: 125,677,884	V183A	possibly damaging	Het
H2-T22	A	T	17: 36,040,517	Y274N	probably benign	Het
Hif1a	T	A	12: 73,937,745	Y313N	probably damaging	Het
Hip1r	T	A	5: 124,000,204	M787K	probably damaging	Het
Hipk3	T	C	2: 104,439,392	E484G	probably damaging	Het
Hsh2d	T	A	8: 72,200,646	F291I	probably benign	Het
Ino80	T	C	2: 119,431,929	E692G	probably null	Het
Itgam	T	A	7: 128,081,712	V271D	probably damaging	Het
Kansl1	A	C	11: 104,335,559	I924S	probably damaging	Het
Kcnq2	A	G	2: 181,081,352	C628R	probably benign	Het
Krt78	A	C	15: 101,947,414	V654G	possibly damaging	Het
Lrit2	A	G	14: 37,071,956	T326A	probably damaging	Het
Ltk	T	C	2: 119,752,088	E710G	probably damaging	Het
Lysmd1	T	C	3: 95,134,974	L53S	probably damaging	Het
Mc4r	T	C	18: 66,859,598	Y148C	probably damaging	Het
Mfn2	G	A	4: 147,888,705	Q172*	probably null	Het
Mknk2	A	G	10: 80,668,601	L242P	possibly damaging	Het
Mrpl45	A	T	11: 97,325,747	H167L	probably benign	Het
Myc	T	C	15: 61,988,102	V208A	probably damaging	Het
Myh7b	A	G	2: 155,629,457	E1175G	probably benign	Het
Myo18a	A	T	11: 77,850,234	M1456L	probably benign	Het
Myocd	G	A	11: 65,218,658	Q96*	probably null	Het
Nckap5	T	A	1: 126,026,518	I766F	probably damaging	Het
Ndst1	T	C	18: 60,691,253	E784G	probably benign	Het
Nf1	A	T	11: 79,469,826	R1443S	possibly damaging	Het
Nhlrc3	A	G	3: 53,453,651	W228R	probably damaging	Het
Nup107	G	A	10: 117,773,320	T378I	probably damaging	Het
Olfr1033	C	T	2: 86,041,330	T5I	probably damaging	Het
Olfr1131	A	G	2: 87,628,939	T159A	probably benign	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr524	T	A	7: 140,202,743	D9V	probably benign	Het
Olfr607	T	A	7: 103,460,273		probably null	Het
Olfr98	A	T	17: 37,263,073	M197K	probably benign	Het
Otop1	A	G	5: 38,300,458	D520G	probably benign	Het
Papln	C	T	12: 83,780,236	P712S	probably benign	Het
Pcbd2	T	A	13: 55,733,033	I34N	probably damaging	Het
Pkd1l3	T	A	8: 109,647,573	C29*	probably null	Het
Pou5f1	G	A	17: 35,510,002	V114M	probably benign	Het
Prpf4b	C	A	13: 34,884,231		probably benign	Het
Prr23a1	C	T	9: 98,842,656	P24S	probably damaging	Het
Ptch1	T	A	13: 63,545,245	M65L	probably benign	Het
Rc3h2	A	T	2: 37,399,624	I392K	possibly damaging	Het
Reck	G	T	4: 43,943,195	D916Y	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Ryr1	G	T	7: 29,090,150	T1513K	probably damaging	Het
Sacs	A	G	14: 61,173,441	D55G	possibly damaging	Het
Scn9a	A	G	2: 66,568,183	S28P	probably benign	Het
Scrn3	A	G	2: 73,329,852	M280V	probably damaging	Het
Snx29	C	T	16: 11,511,034	T559I	possibly damaging	Het
Spn	C	T	7: 127,136,241	E109K	probably damaging	Het
Sra1	C	T	18: 36,675,068	R369H	probably benign	Het
Srsf11	C	T	3: 158,019,345	A64T	probably damaging	Het
Stk17b	A	G	1: 53,776,605	S12P	probably benign	Het
Sult1d1	C	A	5: 87,559,802	G153V	probably damaging	Het
Sycp2	A	T	2: 178,350,138		probably null	Het
Tgfb3	T	C	12: 86,069,769	E165G	possibly damaging	Het
Ubn1	T	A	16: 5,077,224	C711*	probably null	Het
Usp13	A	T	3: 32,901,986	D469V	probably damaging	Het
Vmn1r231	A	T	17: 20,890,118	H178Q	possibly damaging	Het
Vwa1	A	G	4: 155,772,793	S183P	probably damaging	Het
Xpo7	A	G	14: 70,690,991	I424T	probably benign	Het
Zfp109	A	G	7: 24,236,616		probably null	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2304:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4599:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4776:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7061:Tns2	UTSW	15	102104479	start codon destroyed	probably null
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
R8906:Tns2	UTSW	15	102111604	missense	probably damaging	1.00
R8964:Tns2	UTSW	15	102103118	missense	possibly damaging	0.73
R9192:Tns2	UTSW	15	102112981	missense	probably damaging	1.00
R9273:Tns2	UTSW	15	102113043	missense	probably damaging	1.00
R9307:Tns2	UTSW	15	102110561	missense	probably damaging	0.97
R9402:Tns2	UTSW	15	102113188	missense	probably damaging	0.99
R9612:Tns2	UTSW	15	102107142	missense	probably damaging	1.00
R9655:Tns2	UTSW	15	102104498	missense	probably benign	0.03
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATACCTGAAATGGGGCTGG -3'
(R):5'- AGTAGTAGTCCACAATAGCTTGG -3'

Sequencing Primer
(F):5'- CTGAAATGGGGCTGGCAAGG -3'
(R):5'- GGAAATTTTCCGCCATACTGTG -3'

Posted On

2014-09-18