Incidental Mutation 'R2105:Tns2'
ID 230913
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Name tensin 2
Synonyms nep, Tenc1, nph
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102008848-102024836 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 102015941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 160 (H160N)
Ref Sequence ENSEMBL: ENSMUSP00000155624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
AlphaFold Q8CGB6
Predicted Effect probably benign
Transcript: ENSMUST00000046144
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: H183N

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169627
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: H183N

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228958
AA Change: H183N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000229592
AA Change: H160N

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably benign
Transcript: ENSMUST00000230474
AA Change: H175N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102,021,626 (GRCm39) missense probably damaging 1.00
IGL01935:Tns2 APN 15 102,020,069 (GRCm39) splice site probably null
IGL01994:Tns2 APN 15 102,019,814 (GRCm39) missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102,020,484 (GRCm39) nonsense probably null
IGL02135:Tns2 APN 15 102,021,461 (GRCm39) missense probably damaging 1.00
IGL02355:Tns2 APN 15 102,020,725 (GRCm39) missense probably benign
IGL02362:Tns2 APN 15 102,020,725 (GRCm39) missense probably benign
IGL02439:Tns2 APN 15 102,022,978 (GRCm39) missense probably damaging 1.00
IGL02488:Tns2 APN 15 102,021,178 (GRCm39) missense probably benign
IGL02546:Tns2 APN 15 102,019,375 (GRCm39) missense probably damaging 1.00
IGL02616:Tns2 APN 15 102,019,850 (GRCm39) missense probably benign
IGL02628:Tns2 APN 15 102,020,263 (GRCm39) missense probably benign 0.04
IGL02658:Tns2 APN 15 102,016,231 (GRCm39) splice site probably benign
IGL03267:Tns2 APN 15 102,013,813 (GRCm39) critical splice donor site probably null
P0005:Tns2 UTSW 15 102,022,491 (GRCm39) missense probably damaging 0.98
R0586:Tns2 UTSW 15 102,018,020 (GRCm39) splice site probably benign
R0791:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R0817:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R0818:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R0819:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R0820:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1451:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1452:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1453:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1454:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1455:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1487:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1510:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1579:Tns2 UTSW 15 102,019,645 (GRCm39) missense probably damaging 1.00
R1698:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1772:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1779:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1843:Tns2 UTSW 15 102,021,568 (GRCm39) splice site probably null
R1923:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1924:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1927:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R1980:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2051:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2087:Tns2 UTSW 15 102,015,554 (GRCm39) missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2103:Tns2 UTSW 15 102,021,100 (GRCm39) critical splice acceptor site probably null
R2224:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2225:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2227:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2252:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2253:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2290:Tns2 UTSW 15 102,020,458 (GRCm39) missense probably damaging 0.99
R2304:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2318:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2446:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2447:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2448:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2566:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2567:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2897:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R2898:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3159:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3160:Tns2 UTSW 15 102,021,771 (GRCm39) missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102,021,771 (GRCm39) missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102,021,771 (GRCm39) missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3237:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3426:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3427:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3428:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3695:Tns2 UTSW 15 102,021,184 (GRCm39) missense probably null
R3767:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R3911:Tns2 UTSW 15 102,022,272 (GRCm39) critical splice donor site probably null
R4113:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4157:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4394:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4395:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4396:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4439:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4441:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4537:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4538:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4541:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4599:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4600:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4602:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4773:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4774:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4775:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4776:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R4880:Tns2 UTSW 15 102,020,474 (GRCm39) missense probably damaging 0.98
R4989:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5014:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5058:Tns2 UTSW 15 102,016,295 (GRCm39) missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102,019,888 (GRCm39) missense probably damaging 1.00
R5336:Tns2 UTSW 15 102,019,664 (GRCm39) missense probably damaging 1.00
R5351:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5452:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5453:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5629:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5630:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5631:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R5685:Tns2 UTSW 15 102,015,538 (GRCm39) missense probably benign 0.02
R5844:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6048:Tns2 UTSW 15 102,019,846 (GRCm39) missense probably damaging 1.00
R6067:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6079:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6130:Tns2 UTSW 15 102,019,676 (GRCm39) missense probably damaging 1.00
R6136:Tns2 UTSW 15 102,015,465 (GRCm39) missense probably damaging 1.00
R6138:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6199:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6210:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
R6426:Tns2 UTSW 15 102,015,472 (GRCm39) missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102,022,269 (GRCm39) missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102,018,994 (GRCm39) missense probably benign 0.00
R6596:Tns2 UTSW 15 102,018,994 (GRCm39) missense probably benign 0.00
R6734:Tns2 UTSW 15 102,011,551 (GRCm39) missense probably damaging 0.96
R7061:Tns2 UTSW 15 102,012,914 (GRCm39) start codon destroyed probably null
R7070:Tns2 UTSW 15 102,012,968 (GRCm39) missense possibly damaging 0.58
R7110:Tns2 UTSW 15 102,013,801 (GRCm39) missense probably damaging 0.99
R7410:Tns2 UTSW 15 102,018,961 (GRCm39) missense probably damaging 1.00
R7447:Tns2 UTSW 15 102,019,351 (GRCm39) missense probably damaging 1.00
R7751:Tns2 UTSW 15 102,018,163 (GRCm39) missense probably benign 0.02
R8052:Tns2 UTSW 15 102,021,280 (GRCm39) missense probably damaging 1.00
R8114:Tns2 UTSW 15 102,019,825 (GRCm39) missense probably benign 0.01
R8906:Tns2 UTSW 15 102,020,039 (GRCm39) missense probably damaging 1.00
R8964:Tns2 UTSW 15 102,011,553 (GRCm39) missense possibly damaging 0.73
R9192:Tns2 UTSW 15 102,021,416 (GRCm39) missense probably damaging 1.00
R9273:Tns2 UTSW 15 102,021,478 (GRCm39) missense probably damaging 1.00
R9307:Tns2 UTSW 15 102,018,996 (GRCm39) missense probably damaging 0.97
R9402:Tns2 UTSW 15 102,021,623 (GRCm39) missense probably damaging 0.99
R9612:Tns2 UTSW 15 102,015,577 (GRCm39) missense probably damaging 1.00
R9655:Tns2 UTSW 15 102,012,933 (GRCm39) missense probably benign 0.03
U15987:Tns2 UTSW 15 102,017,369 (GRCm39) missense probably damaging 1.00
X0009:Tns2 UTSW 15 102,020,900 (GRCm39) missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102,018,937 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATACCTGAAATGGGGCTGG -3'
(R):5'- AGTAGTAGTCCACAATAGCTTGG -3'

Sequencing Primer
(F):5'- CTGAAATGGGGCTGGCAAGG -3'
(R):5'- GGAAATTTTCCGCCATACTGTG -3'
Posted On 2014-09-18