Incidental Mutation 'R2105:Sra1'
ID230921
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Namesteroid receptor RNA activator 1
SynonymsSrap
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36666681-36679366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36675068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 369 (R369H)
Ref Sequence ENSEMBL: ENSMUSP00000001415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000173875] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
AA Change: R369H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050
AA Change: R369H

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000006209
SMART Domains Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 65 208 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036158
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173202
Predicted Effect probably benign
Transcript: ENSMUST00000173482
Predicted Effect probably benign
Transcript: ENSMUST00000173875
SMART Domains Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
Pfam:SRA1 72 217 1.1e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174125
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36668739 missense probably benign 0.36
IGL01390:Sra1 APN 18 36670081 missense probably damaging 1.00
IGL01645:Sra1 APN 18 36671473 missense probably damaging 1.00
IGL02478:Sra1 APN 18 36668792 missense probably benign 0.00
IGL02578:Sra1 APN 18 36670097 nonsense probably null
R0218:Sra1 UTSW 18 36676609 unclassified probably benign
R0243:Sra1 UTSW 18 36675706 nonsense probably null
R0432:Sra1 UTSW 18 36677503 missense probably benign
R0834:Sra1 UTSW 18 36668776 missense probably benign 0.00
R1886:Sra1 UTSW 18 36668777 missense probably benign
R2911:Sra1 UTSW 18 36676185 missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36676441 nonsense probably null
R5034:Sra1 UTSW 18 36678995 critical splice donor site probably null
R5091:Sra1 UTSW 18 36669959 intron probably benign
R5122:Sra1 UTSW 18 36667594 missense probably benign 0.03
R5656:Sra1 UTSW 18 36678407 missense probably damaging 0.99
R5722:Sra1 UTSW 18 36674978 missense probably damaging 1.00
R5726:Sra1 UTSW 18 36670173 intron probably benign
R5729:Sra1 UTSW 18 36667443 utr 3 prime probably benign
R5937:Sra1 UTSW 18 36671599 splice site probably null
R6145:Sra1 UTSW 18 36667575 missense probably damaging 1.00
R6161:Sra1 UTSW 18 36670283 missense probably damaging 0.99
R7423:Sra1 UTSW 18 36667483 missense probably benign 0.00
R8074:Sra1 UTSW 18 36675011 missense possibly damaging 0.89
R8100:Sra1 UTSW 18 36676895 missense probably damaging 1.00
Z1176:Sra1 UTSW 18 36670009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTACAGAGTGGCCACAG -3'
(R):5'- TGCTATCCAGGTACCACTGAAG -3'

Sequencing Primer
(F):5'- TACAGAGTGGCCACAGGGAAAC -3'
(R):5'- ACATTCAGGGCCTTGGAGG -3'
Posted On2014-09-18