Mutagenetix > Incidental Mutation

Incidental Mutation 'R2105:Ndst1'

230922

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

040109-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2105 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60691253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 784 (E784G)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: E784G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: E784G

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	T	6: 121,673,500	P1189L	probably benign	Het
Acbd4	G	A	11: 103,104,439	D57N	probably damaging	Het
Acot4	A	T	12: 84,038,742	M78L	probably damaging	Het
Ago1	A	T	4: 126,461,788	M76K	probably benign	Het
Agrn	G	T	4: 156,177,299	Y511*	probably null	Het
Arhgef15	A	T	11: 68,947,681		probably null	Het
Atp1a3	A	T	7: 24,989,853	M594K	probably damaging	Het
Atp4a	G	A	7: 30,720,368		probably null	Het
Bckdk	T	A	7: 127,907,317	I272N	probably damaging	Het
Bod1l	A	G	5: 41,832,279	V367A	probably benign	Het
C1galt1c1	T	C	X: 38,631,268	M284V	possibly damaging	Het
Cenpk	T	A	13: 104,229,597	C4*	probably null	Het
Cfap53	T	C	18: 74,283,223	V9A	possibly damaging	Het
Chil3	T	C	3: 106,160,478	I124V	possibly damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Cyp2c67	T	C	19: 39,626,237	Y282C	probably benign	Het
D5Ertd579e	C	T	5: 36,613,449	A1201T	probably benign	Het
Dock4	A	G	12: 40,692,989	H381R	probably benign	Het
Drc1	C	T	5: 30,356,441	S447F	probably benign	Het
Fam83g	G	T	11: 61,703,458	R606L	probably benign	Het
Fmnl1	A	C	11: 103,194,692	S688R	probably benign	Het
Fryl	C	T	5: 73,122,299	V219I	probably benign	Het
Gm13101	A	T	4: 143,965,820	Y204N	probably benign	Het
Golgb1	T	A	16: 36,914,664	N1424K	probably benign	Het
Gpr39	T	C	1: 125,677,884	V183A	possibly damaging	Het
H2-T22	A	T	17: 36,040,517	Y274N	probably benign	Het
Hif1a	T	A	12: 73,937,745	Y313N	probably damaging	Het
Hip1r	T	A	5: 124,000,204	M787K	probably damaging	Het
Hipk3	T	C	2: 104,439,392	E484G	probably damaging	Het
Hsh2d	T	A	8: 72,200,646	F291I	probably benign	Het
Ino80	T	C	2: 119,431,929	E692G	probably null	Het
Itgam	T	A	7: 128,081,712	V271D	probably damaging	Het
Kansl1	A	C	11: 104,335,559	I924S	probably damaging	Het
Kcnq2	A	G	2: 181,081,352	C628R	probably benign	Het
Krt78	A	C	15: 101,947,414	V654G	possibly damaging	Het
Lrit2	A	G	14: 37,071,956	T326A	probably damaging	Het
Ltk	T	C	2: 119,752,088	E710G	probably damaging	Het
Lysmd1	T	C	3: 95,134,974	L53S	probably damaging	Het
Mc4r	T	C	18: 66,859,598	Y148C	probably damaging	Het
Mfn2	G	A	4: 147,888,705	Q172*	probably null	Het
Mknk2	A	G	10: 80,668,601	L242P	possibly damaging	Het
Mrpl45	A	T	11: 97,325,747	H167L	probably benign	Het
Myc	T	C	15: 61,988,102	V208A	probably damaging	Het
Myh7b	A	G	2: 155,629,457	E1175G	probably benign	Het
Myo18a	A	T	11: 77,850,234	M1456L	probably benign	Het
Myocd	G	A	11: 65,218,658	Q96*	probably null	Het
Nckap5	T	A	1: 126,026,518	I766F	probably damaging	Het
Nf1	A	T	11: 79,469,826	R1443S	possibly damaging	Het
Nhlrc3	A	G	3: 53,453,651	W228R	probably damaging	Het
Nup107	G	A	10: 117,773,320	T378I	probably damaging	Het
Olfr1033	C	T	2: 86,041,330	T5I	probably damaging	Het
Olfr1131	A	G	2: 87,628,939	T159A	probably benign	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr524	T	A	7: 140,202,743	D9V	probably benign	Het
Olfr607	T	A	7: 103,460,273		probably null	Het
Olfr98	A	T	17: 37,263,073	M197K	probably benign	Het
Otop1	A	G	5: 38,300,458	D520G	probably benign	Het
Papln	C	T	12: 83,780,236	P712S	probably benign	Het
Pcbd2	T	A	13: 55,733,033	I34N	probably damaging	Het
Pkd1l3	T	A	8: 109,647,573	C29*	probably null	Het
Pou5f1	G	A	17: 35,510,002	V114M	probably benign	Het
Prpf4b	C	A	13: 34,884,231		probably benign	Het
Prr23a1	C	T	9: 98,842,656	P24S	probably damaging	Het
Ptch1	T	A	13: 63,545,245	M65L	probably benign	Het
Rc3h2	A	T	2: 37,399,624	I392K	possibly damaging	Het
Reck	G	T	4: 43,943,195	D916Y	probably damaging	Het
Rtf2	A	G	2: 172,445,365	D68G	probably damaging	Het
Ryr1	G	T	7: 29,090,150	T1513K	probably damaging	Het
Sacs	A	G	14: 61,173,441	D55G	possibly damaging	Het
Scn9a	A	G	2: 66,568,183	S28P	probably benign	Het
Scrn3	A	G	2: 73,329,852	M280V	probably damaging	Het
Snx29	C	T	16: 11,511,034	T559I	possibly damaging	Het
Spn	C	T	7: 127,136,241	E109K	probably damaging	Het
Sra1	C	T	18: 36,675,068	R369H	probably benign	Het
Srsf11	C	T	3: 158,019,345	A64T	probably damaging	Het
Stk17b	A	G	1: 53,776,605	S12P	probably benign	Het
Sult1d1	C	A	5: 87,559,802	G153V	probably damaging	Het
Sycp2	A	T	2: 178,350,138		probably null	Het
Tgfb3	T	C	12: 86,069,769	E165G	possibly damaging	Het
Tns2	C	A	15: 102,107,506	H160N	probably benign	Het
Ubn1	T	A	16: 5,077,224	C711*	probably null	Het
Usp13	A	T	3: 32,901,986	D469V	probably damaging	Het
Vmn1r231	A	T	17: 20,890,118	H178Q	possibly damaging	Het
Vwa1	A	G	4: 155,772,793	S183P	probably damaging	Het
Xpo7	A	G	14: 70,690,991	I424T	probably benign	Het
Zfp109	A	G	7: 24,236,616		probably null	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCGGGGAAGAAGTGCATG -3'
(R):5'- GAGCATGTATATCCTTGGCAGAG -3'

Sequencing Primer
(F):5'- CGGGGAAGAAGTGCATGTTTTCTTAC -3'
(R):5'- GGATGCCGAGTTGGGGTAAC -3'

Posted On

2014-09-18