Incidental Mutation 'R2106:Kcnd3'
ID230940
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105658766 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 421 (A421V)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
R8022:Kcnd3 UTSW 3 105458873 missense probably benign 0.19
Z1177:Kcnd3 UTSW 3 105459570 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGAAGCCCCACTTGTTTCC -3'
(R):5'- GGCTAACTGAGGACATTGGTG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- CTAACTGAGGACATTGGTGGGTAG -3'
Posted On2014-09-18