Mutagenetix > Incidental Mutations

Incidental Mutation 'R2106:Slc26a5'

230952

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

Pres, prestin

MMRRC Submission

040110-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2106 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21810655-21865604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21823544 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 342 (D342V)

Ref Sequence

ENSEMBL: ENSMUSP00000118263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030878
AA Change: D342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: D342V

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115176
AA Change: D305V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: D305V

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127975
AA Change: D342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: D342V

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000142888
AA Change: D342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: D342V

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150012

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl2	T	C	2: 27,102,825	F650S	probably benign	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akr1c13	T	A	13: 4,198,594	V266E	probably damaging	Het
Ankrd61	A	T	5: 143,891,746	L95Q	probably damaging	Het
Atp11a	A	G	8: 12,835,228	T22A	probably benign	Het
Brca1	A	G	11: 101,524,977	V777A	possibly damaging	Het
Ccdc40	G	T	11: 119,264,297	R1121L	probably damaging	Het
Cdhr4	A	C	9: 107,997,494	S588R	possibly damaging	Het
Cfap69	T	C	5: 5,595,979	N517D	probably benign	Het
Chrm2	T	C	6: 36,523,447	Y80H	probably damaging	Het
Csgalnact2	G	T	6: 118,109,129	Y534*	probably null	Het
Defb35	A	G	8: 21,940,793	E61G	unknown	Het
Dhx15	A	T	5: 52,170,086	D95E	probably benign	Het
Dhx57	A	G	17: 80,275,363	V271A	probably damaging	Het
Dlg1	T	C	16: 31,812,756	S444P	probably damaging	Het
Edem1	T	A	6: 108,848,725	N406K	probably damaging	Het
Eif4g3	A	T	4: 138,082,919		probably benign	Het
Epb41	A	G	4: 131,989,841	I56T	probably damaging	Het
Epg5	T	A	18: 77,991,363	Y1442*	probably null	Het
Fam166a	A	G	2: 25,220,651	Y157C	probably damaging	Het
Fat2	T	C	11: 55,256,564	T3951A	probably benign	Het
Fryl	A	G	5: 73,098,331	S786P	probably damaging	Het
Fyb2	A	G	4: 104,945,572	T224A	probably benign	Het
Ginm1	A	T	10: 7,775,326	F105L	probably damaging	Het
Heatr1	T	C	13: 12,412,058	V688A	probably benign	Het
Hnmt	T	G	2: 24,019,118	Q94H	probably benign	Het
Ice1	A	G	13: 70,605,622	Y782H	probably benign	Het
Immt	T	C	6: 71,871,515	V418A	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Krt84	T	C	15: 101,530,866	N248D	probably damaging	Het
Lig1	C	A	7: 13,305,938	R692S	probably damaging	Het
Lvrn	G	T	18: 46,878,289	A438S	probably damaging	Het
Mast4	C	T	13: 102,750,546	V1204I	probably damaging	Het
Med21	G	T	6: 146,649,212	D74Y	probably damaging	Het
Nat8	T	C	6: 85,830,524	D209G	probably benign	Het
Nipal1	C	A	5: 72,663,559	F132L	probably damaging	Het
Npr2	A	T	4: 43,644,329	I613F	probably damaging	Het
Nrcam	A	G	12: 44,570,290	T706A	probably benign	Het
Olfr1132	T	C	2: 87,635,159	E196G	probably benign	Het
Olfr1133	A	G	2: 87,645,551	S191P	probably damaging	Het
Pam	A	G	1: 97,831,490	V823A	probably damaging	Het
Pdik1l	A	T	4: 134,284,254	Y93N	probably damaging	Het
Perm1	T	C	4: 156,218,879	W627R	probably damaging	Het
Pofut1	G	A	2: 153,259,793		probably null	Het
Prmt5	T	C	14: 54,507,917	I598V	probably benign	Het
Rab11fip5	T	C	6: 85,374,387	I48V	probably damaging	Het
Rad51d	T	A	11: 82,879,308	K261N	probably damaging	Het
Rapgef6	T	G	11: 54,668,686	I1050S	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ryr3	T	C	2: 112,638,129	E4688G	probably damaging	Het
Siva1	G	T	12: 112,647,006	R96L	probably damaging	Het
Slc13a4	T	C	6: 35,287,864	N140S	probably damaging	Het
Slfn9	A	G	11: 82,987,680	S208P	possibly damaging	Het
Sspo	C	A	6: 48,466,316	T1899N	possibly damaging	Het
Sytl1	T	C	4: 133,257,463	D200G	probably benign	Het
Tas2r118	T	C	6: 23,969,570	N164S	probably benign	Het
Tbc1d17	A	G	7: 44,848,268		probably null	Het
Tex14	T	C	11: 87,486,250	M140T	possibly damaging	Het
Tm6sf2	T	C	8: 70,079,746	F352S	probably benign	Het
Tmem88	A	G	11: 69,397,859	L78P	probably benign	Het
Trafd1	A	G	5: 121,373,211	S515P	probably benign	Het
Trpm6	A	T	19: 18,813,350	E583V	possibly damaging	Het
Ttc23l	A	G	15: 10,547,256	C91R	probably damaging	Het
Ubap1l	T	C	9: 65,373,807	S256P	probably benign	Het
Vmn1r26	T	G	6: 58,008,725	S160R	possibly damaging	Het
Vmn2r97	A	G	17: 18,947,838	S785G	probably damaging	Het
Wdr27	T	G	17: 14,920,854	R278S	probably benign	Het
Wdr7	T	C	18: 63,778,038	S834P	probably damaging	Het
Zdhhc12	C	T	2: 30,091,802	C116Y	probably damaging	Het
Zfp946	T	C	17: 22,453,485	F22L	probably benign	Het
Zfp948	G	T	17: 21,587,691	E382*	probably null	Het
Zfp956	T	A	6: 47,964,425	*573K	probably null	Het
Zim1	T	G	7: 6,678,074	T197P	probably benign	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	21815736	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	21846325	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	21819767	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	21813383	splice site	probably benign
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	21811344	splice site	probably null
R0136:Slc26a5	UTSW	5	21834347	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	21823549	nonsense	probably null
R0522:Slc26a5	UTSW	5	21846345	missense	probably damaging	0.96
R0557:Slc26a5	UTSW	5	21819764	missense	probably damaging	1.00
R0711:Slc26a5	UTSW	5	21847232	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	21816961	missense	probably benign	0.01
R1214:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R1471:Slc26a5	UTSW	5	21816964	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1648:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1861:Slc26a5	UTSW	5	21816958	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	21815727	missense	probably benign	0.03
R2169:Slc26a5	UTSW	5	21813865	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	21823478	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	21823547	missense	probably benign	0.39
R2281:Slc26a5	UTSW	5	21831510	missense	possibly damaging	0.94
R2325:Slc26a5	UTSW	5	21819694	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	21847191	missense	probably damaging	1.00
R4793:Slc26a5	UTSW	5	21837994	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	21820386	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	21847196	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	21813901	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	21847260	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	21816976	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	21823563	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	21821097	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	21820350	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	21819719	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	21834344	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	21840572	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	21811336	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	21816974	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	21813894	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	21837246	nonsense	probably null
R7650:Slc26a5	UTSW	5	21834330	missense	possibly damaging	0.96
R8431:Slc26a5	UTSW	5	21813906	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGAGTACATTGCAGTGCC -3'
(R):5'- AAGAAGCAACAGGGTCATCTC -3'

Sequencing Primer
(F):5'- AGGCTTTCCTACGAAGCTAGC -3'
(R):5'- AACAGGGTCATCTCATGTGC -3'

Posted On

2014-09-18