Mutagenetix > Incidental Mutations

Incidental Mutation 'R2106:Fryl'

230955

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

040110-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.767) question?

Stock #

R2106 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73098331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 786 (S786P)

Ref Sequence

ENSEMBL: ENSMUSP00000098687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000094700
AA Change: S786P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: S786P

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101127
AA Change: S786P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: S786P

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201405

SMART Domains

Protein: ENSMUSP00000144346
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
low complexity region	103	114	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl2	T	C	2: 27,102,825	F650S	probably benign	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Akr1c13	T	A	13: 4,198,594	V266E	probably damaging	Het
Ankrd61	A	T	5: 143,891,746	L95Q	probably damaging	Het
Atp11a	A	G	8: 12,835,228	T22A	probably benign	Het
Brca1	A	G	11: 101,524,977	V777A	possibly damaging	Het
Ccdc40	G	T	11: 119,264,297	R1121L	probably damaging	Het
Cdhr4	A	C	9: 107,997,494	S588R	possibly damaging	Het
Cfap69	T	C	5: 5,595,979	N517D	probably benign	Het
Chrm2	T	C	6: 36,523,447	Y80H	probably damaging	Het
Csgalnact2	G	T	6: 118,109,129	Y534*	probably null	Het
Defb35	A	G	8: 21,940,793	E61G	unknown	Het
Dhx15	A	T	5: 52,170,086	D95E	probably benign	Het
Dhx57	A	G	17: 80,275,363	V271A	probably damaging	Het
Dlg1	T	C	16: 31,812,756	S444P	probably damaging	Het
Edem1	T	A	6: 108,848,725	N406K	probably damaging	Het
Eif4g3	A	T	4: 138,082,919		probably benign	Het
Epb41	A	G	4: 131,989,841	I56T	probably damaging	Het
Epg5	T	A	18: 77,991,363	Y1442*	probably null	Het
Fam166a	A	G	2: 25,220,651	Y157C	probably damaging	Het
Fat2	T	C	11: 55,256,564	T3951A	probably benign	Het
Fyb2	A	G	4: 104,945,572	T224A	probably benign	Het
Ginm1	A	T	10: 7,775,326	F105L	probably damaging	Het
Heatr1	T	C	13: 12,412,058	V688A	probably benign	Het
Hnmt	T	G	2: 24,019,118	Q94H	probably benign	Het
Ice1	A	G	13: 70,605,622	Y782H	probably benign	Het
Immt	T	C	6: 71,871,515	V418A	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Krt84	T	C	15: 101,530,866	N248D	probably damaging	Het
Lig1	C	A	7: 13,305,938	R692S	probably damaging	Het
Lvrn	G	T	18: 46,878,289	A438S	probably damaging	Het
Mast4	C	T	13: 102,750,546	V1204I	probably damaging	Het
Med21	G	T	6: 146,649,212	D74Y	probably damaging	Het
Nat8	T	C	6: 85,830,524	D209G	probably benign	Het
Nipal1	C	A	5: 72,663,559	F132L	probably damaging	Het
Npr2	A	T	4: 43,644,329	I613F	probably damaging	Het
Nrcam	A	G	12: 44,570,290	T706A	probably benign	Het
Olfr1132	T	C	2: 87,635,159	E196G	probably benign	Het
Olfr1133	A	G	2: 87,645,551	S191P	probably damaging	Het
Pam	A	G	1: 97,831,490	V823A	probably damaging	Het
Pdik1l	A	T	4: 134,284,254	Y93N	probably damaging	Het
Perm1	T	C	4: 156,218,879	W627R	probably damaging	Het
Pofut1	G	A	2: 153,259,793		probably null	Het
Prmt5	T	C	14: 54,507,917	I598V	probably benign	Het
Rab11fip5	T	C	6: 85,374,387	I48V	probably damaging	Het
Rad51d	T	A	11: 82,879,308	K261N	probably damaging	Het
Rapgef6	T	G	11: 54,668,686	I1050S	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ryr3	T	C	2: 112,638,129	E4688G	probably damaging	Het
Siva1	G	T	12: 112,647,006	R96L	probably damaging	Het
Slc13a4	T	C	6: 35,287,864	N140S	probably damaging	Het
Slc26a5	T	A	5: 21,823,544	D342V	probably damaging	Het
Slfn9	A	G	11: 82,987,680	S208P	possibly damaging	Het
Sspo	C	A	6: 48,466,316	T1899N	possibly damaging	Het
Sytl1	T	C	4: 133,257,463	D200G	probably benign	Het
Tas2r118	T	C	6: 23,969,570	N164S	probably benign	Het
Tbc1d17	A	G	7: 44,848,268		probably null	Het
Tex14	T	C	11: 87,486,250	M140T	possibly damaging	Het
Tm6sf2	T	C	8: 70,079,746	F352S	probably benign	Het
Tmem88	A	G	11: 69,397,859	L78P	probably benign	Het
Trafd1	A	G	5: 121,373,211	S515P	probably benign	Het
Trpm6	A	T	19: 18,813,350	E583V	possibly damaging	Het
Ttc23l	A	G	15: 10,547,256	C91R	probably damaging	Het
Ubap1l	T	C	9: 65,373,807	S256P	probably benign	Het
Vmn1r26	T	G	6: 58,008,725	S160R	possibly damaging	Het
Vmn2r97	A	G	17: 18,947,838	S785G	probably damaging	Het
Wdr27	T	G	17: 14,920,854	R278S	probably benign	Het
Wdr7	T	C	18: 63,778,038	S834P	probably damaging	Het
Zdhhc12	C	T	2: 30,091,802	C116Y	probably damaging	Het
Zfp946	T	C	17: 22,453,485	F22L	probably benign	Het
Zfp948	G	T	17: 21,587,691	E382*	probably null	Het
Zfp956	T	A	6: 47,964,425	*573K	probably null	Het
Zim1	T	G	7: 6,678,074	T197P	probably benign	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2256:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6823:Fryl	UTSW	5	73065217	missense	probably damaging	0.99
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	splice site	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
R7774:Fryl	UTSW	5	73083384	missense	probably benign	0.12
R7777:Fryl	UTSW	5	73071298	missense	probably damaging	0.98
R7917:Fryl	UTSW	5	73054532	missense	probably damaging	1.00
R7920:Fryl	UTSW	5	73101807	splice site	probably null
R8110:Fryl	UTSW	5	73133277	missense	probably benign	0.10
R8120:Fryl	UTSW	5	73071184	missense	probably benign	0.01
R8143:Fryl	UTSW	5	73050339	missense	probably benign	0.00
R8207:Fryl	UTSW	5	73100500	splice site	probably null
R8263:Fryl	UTSW	5	73081005	missense	probably damaging	1.00
R8350:Fryl	UTSW	5	73068730	missense	probably benign
R8359:Fryl	UTSW	5	73075933	missense	probably benign	0.39
R8387:Fryl	UTSW	5	73136320	critical splice donor site	probably null
R8403:Fryl	UTSW	5	73118447	makesense	probably null
R8450:Fryl	UTSW	5	73068730	missense	probably benign
R8514:Fryl	UTSW	5	73085356	missense	probably benign
R8536:Fryl	UTSW	5	73100353	missense	probably damaging	0.99
R8703:Fryl	UTSW	5	73090654	missense	probably damaging	0.99
R8708:Fryl	UTSW	5	73132562	missense	probably benign	0.01
R8783:Fryl	UTSW	5	73068842	missense	probably benign	0.45
R9028:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R9045:Fryl	UTSW	5	73024775	missense
R9063:Fryl	UTSW	5	73081003	missense	possibly damaging	0.70
R9096:Fryl	UTSW	5	73108577	missense	probably benign	0.01
R9345:Fryl	UTSW	5	73050411	missense	probably benign
R9381:Fryl	UTSW	5	73083294	missense	probably benign	0.24
R9386:Fryl	UTSW	5	73191809	missense	unknown
R9401:Fryl	UTSW	5	73065220	nonsense	probably null
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00
Z1176:Fryl	UTSW	5	73072837	missense	probably benign
Z1177:Fryl	UTSW	5	73041595	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCACTTACTTTATATCCACCTGGG -3'
(R):5'- AGCTTCAGCCACATTCCATG -3'

Sequencing Primer
(F):5'- GGGGACAAGAGCTGCAGC -3'
(R):5'- ATGTCTTCTATTCCAGAAAGCACC -3'

Posted On

2014-09-18