Incidental Mutation 'R2106:Chrm2'
ID 230963
Institutional Source Beutler Lab
Gene Symbol Chrm2
Ensembl Gene ENSMUSG00000045613
Gene Name cholinergic receptor, muscarinic 2, cardiac
Synonyms muscarinic acetylcholine receptor 2, M2, Chrm-2, AChR M2
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R2106 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 36388084-36528414 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36523447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 80 (Y80H)
Ref Sequence ENSEMBL: ENSMUSP00000130874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172278]
AlphaFold Q9ERZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000172278
AA Change: Y80H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130874
Gene: ENSMUSG00000045613
AA Change: Y80H

DomainStartEndE-ValueType
Pfam:7tm_1 40 440 2.5e-75 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have slightly decreased body weight (5%) compared to wild-type animals and are resistant to the tremorogenic, analgesic, and hypothermic responses to oxotremorine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Chrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Chrm2 APN 6 36523391 missense probably damaging 1.00
IGL00495:Chrm2 APN 6 36523420 missense possibly damaging 0.61
IGL01011:Chrm2 APN 6 36524438 missense probably benign 0.41
IGL01482:Chrm2 APN 6 36523757 missense possibly damaging 0.95
R0101:Chrm2 UTSW 6 36524495 missense probably damaging 1.00
R0390:Chrm2 UTSW 6 36524111 missense probably benign 0.06
R0539:Chrm2 UTSW 6 36523706 missense possibly damaging 0.69
R0972:Chrm2 UTSW 6 36524466 missense possibly damaging 0.56
R3552:Chrm2 UTSW 6 36523810 missense probably damaging 1.00
R4431:Chrm2 UTSW 6 36524162 missense probably benign
R4910:Chrm2 UTSW 6 36524233 missense probably benign 0.19
R5358:Chrm2 UTSW 6 36523355 missense probably damaging 1.00
R5846:Chrm2 UTSW 6 36523450 missense probably damaging 0.98
R6108:Chrm2 UTSW 6 36523295 missense probably damaging 1.00
R6418:Chrm2 UTSW 6 36523739 missense probably damaging 1.00
R6628:Chrm2 UTSW 6 36523357 missense probably damaging 1.00
R6677:Chrm2 UTSW 6 36524092 missense probably damaging 0.99
R6716:Chrm2 UTSW 6 36524435 missense probably damaging 1.00
R7658:Chrm2 UTSW 6 36523249 missense probably benign 0.00
R8004:Chrm2 UTSW 6 36523286 missense probably damaging 1.00
R8185:Chrm2 UTSW 6 36523889 missense probably benign 0.00
R8277:Chrm2 UTSW 6 36523276 missense probably benign 0.31
R8557:Chrm2 UTSW 6 36524075 missense probably benign
R9395:Chrm2 UTSW 6 36524261 missense possibly damaging 0.50
R9441:Chrm2 UTSW 6 36524020 missense probably benign 0.04
Z1177:Chrm2 UTSW 6 36524607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATTACCAGTCCTTACAAGAC -3'
(R):5'- GCTGCAATCATCATGCCTGC -3'

Sequencing Primer
(F):5'- CAGTCCTTACAAGACATTTGAAGTGG -3'
(R):5'- ATCATGCCTGCCATTTTTGTGG -3'
Posted On 2014-09-18