Incidental Mutation 'R2106:Zim1'
ID230973
Institutional Source Beutler Lab
Gene Symbol Zim1
Ensembl Gene ENSMUSG00000002266
Gene Namezinc finger, imprinted 1
Synonyms
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6671269-6696450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6678074 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 197 (T197P)
Ref Sequence ENSEMBL: ENSMUSP00000145453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002336] [ENSMUST00000122432] [ENSMUST00000203908]
Predicted Effect probably benign
Transcript: ENSMUST00000002336
AA Change: T197P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000002336
Gene: ENSMUSG00000002266
AA Change: T197P

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122432
AA Change: T197P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113585
Gene: ENSMUSG00000002266
AA Change: T197P

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203908
AA Change: T197P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000145453
Gene: ENSMUSG00000002266
AA Change: T197P

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Other mutations in Zim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Zim1 APN 7 6682760 missense possibly damaging 0.95
IGL01921:Zim1 APN 7 6682185 splice site probably benign
IGL02116:Zim1 APN 7 6678254 missense probably benign 0.00
IGL02252:Zim1 APN 7 6688628 missense unknown
IGL02354:Zim1 APN 7 6682874 splice site probably null
IGL02361:Zim1 APN 7 6682874 splice site probably null
IGL03025:Zim1 APN 7 6682059 missense probably benign 0.00
R0003:Zim1 UTSW 7 6676948 missense probably benign 0.01
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1483:Zim1 UTSW 7 6682125 missense probably benign 0.00
R2315:Zim1 UTSW 7 6677068 missense possibly damaging 0.86
R2508:Zim1 UTSW 7 6677430 small insertion probably benign
R2508:Zim1 UTSW 7 6677431 small insertion probably benign
R3706:Zim1 UTSW 7 6677291 missense probably damaging 0.97
R3975:Zim1 UTSW 7 6677130 missense probably damaging 1.00
R5524:Zim1 UTSW 7 6677321 missense probably benign 0.34
R5557:Zim1 UTSW 7 6677711 missense probably damaging 1.00
R5843:Zim1 UTSW 7 6677698 missense possibly damaging 0.59
R5844:Zim1 UTSW 7 6678116 missense probably benign 0.21
R5882:Zim1 UTSW 7 6682738 critical splice donor site probably null
R6828:Zim1 UTSW 7 6677689 missense probably damaging 1.00
R6953:Zim1 UTSW 7 6687707 missense unknown
R7080:Zim1 UTSW 7 6677306 missense possibly damaging 0.92
R7148:Zim1 UTSW 7 6678221 missense possibly damaging 0.91
R7199:Zim1 UTSW 7 6677873 nonsense probably null
R7332:Zim1 UTSW 7 6677353 missense probably damaging 1.00
R7462:Zim1 UTSW 7 6677812 missense probably damaging 1.00
Z1088:Zim1 UTSW 7 6677659 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTTTACCTTGTCGGGCAGGC -3'
(R):5'- CTCCTTCAGGGAAGAAGACAGG -3'

Sequencing Primer
(F):5'- GGATTTGTGGAACTGCTCCTC -3'
(R):5'- GGGATAATTCCACAAAGGCAGAAATC -3'
Posted On2014-09-18