Incidental Mutation 'R2106:Brca1'
ID230995
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101524977 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 777 (V777A)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: V777A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: V777A

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGAGTATCAAGTTCACTGTCTTC -3'
(R):5'- TCTCAAGGGCCTGTCAATCC -3'

Sequencing Primer
(F):5'- CATTTCTACTTTCTCCTGACTGAGG -3'
(R):5'- TGTCAATCCCAGCCCTCAGAG -3'
Posted On2014-09-18