Mutagenetix > Incidental Mutation

Incidental Mutation 'R2117:Gcn1l1'

231054

Institutional Source

Beutler Lab

Gene Symbol

Gcn1l1

Ensembl Gene

ENSMUSG00000041638

Gene Name

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

Synonyms

GCN1L, G431004K08Rik

MMRRC Submission

040121-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R2117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115565254-115622654 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115598825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1276 (M1276L)

Ref Sequence

ENSEMBL: ENSMUSP00000069432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064454]

AlphaFold

E9PVA8

Predicted Effect

probably benign
Transcript: ENSMUST00000064454
AA Change: M1276L

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: M1276L

Domain	Start	End	E-Value	Type
low complexity region	64	84	N/A	INTRINSIC
low complexity region	108	117	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
Pfam:DUF3554	357	705	2e-61	PFAM
coiled coil region	806	866	N/A	INTRINSIC
Blast:ARM	1028	1068	6e-11	BLAST
coiled coil region	1180	1203	N/A	INTRINSIC
low complexity region	1457	1466	N/A	INTRINSIC
low complexity region	1501	1510	N/A	INTRINSIC
ARM	1527	1567	3.69e1	SMART
Blast:ARM	1602	1644	1e-5	BLAST
Blast:EZ_HEAT	1671	1704	1e-7	BLAST
low complexity region	1926	1934	N/A	INTRINSIC
low complexity region	1956	1972	N/A	INTRINSIC
ARM	2034	2070	9.27e1	SMART
low complexity region	2326	2334	N/A	INTRINSIC
ARM	2416	2455	2.16e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151030
AA Change: H877L

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,492,537	C3357S	probably benign	Het
Ago1	T	A	4: 126,463,857		probably null	Het
Akap10	A	T	11: 61,890,303	D562E	possibly damaging	Het
Akr1b7	G	A	6: 34,418,994	A144T	possibly damaging	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Arf5	C	T	6: 28,424,784	Q71*	probably null	Het
Arl15	C	T	13: 113,967,660	S111F	probably damaging	Het
Asph	G	A	4: 9,517,671	Q468*	probably null	Het
Bcam	G	T	7: 19,758,427	A581E	possibly damaging	Het
Blvra	G	T	2: 127,086,069	E80*	probably null	Het
Casc1	C	T	6: 145,205,241		probably null	Het
Ccr6	T	C	17: 8,256,082	F40L	possibly damaging	Het
Cfap161	A	T	7: 83,775,976	N302K	possibly damaging	Het
Ckmt2	T	A	13: 91,855,845	I345F	probably benign	Het
Cpsf6	A	G	10: 117,366,120		probably benign	Het
Ctnna1	A	G	18: 35,152,625	N8S	possibly damaging	Het
Cyp2d11	A	G	15: 82,391,753	L209P	probably damaging	Het
Dab2	T	C	15: 6,435,615	V628A	probably damaging	Het
Dcstamp	C	T	15: 39,755,175	Q327*	probably null	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dlg5	A	T	14: 24,177,758	L365*	probably null	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Exoc3l2	G	T	7: 19,494,982	L108F	possibly damaging	Het
Exoc4	T	A	6: 33,347,825	N351K	possibly damaging	Het
Fam83h	C	A	15: 76,004,733	E252*	probably null	Het
Fancm	A	G	12: 65,077,174	D202G	probably damaging	Het
Fat1	T	A	8: 45,037,463	V3804E	probably benign	Het
Fbxw28	T	C	9: 109,330,917	T190A	probably benign	Het
Fer1l4	T	C	2: 156,039,118	T843A	probably benign	Het
Fnip1	A	T	11: 54,500,624	H461L	probably damaging	Het
Gemin4	A	G	11: 76,211,001	V978A	possibly damaging	Het
Gm7247	A	T	14: 51,365,335	I43F	probably damaging	Het
Gm853	C	A	4: 130,215,363	V295L	possibly damaging	Het
Gm9978	C	T	10: 78,486,897		noncoding transcript	Het
Gpr4	T	C	7: 19,223,145	S331P	probably damaging	Het
Hspa1a	T	A	17: 34,970,479	N483Y	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ints14	T	G	9: 64,979,795	L336R	probably damaging	Het
Irak1	G	T	X: 74,022,612	P197Q	possibly damaging	Het
Kif4	A	G	X: 100,665,717	S315G	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lamb3	A	G	1: 193,334,181	R657G	probably benign	Het
Lrp2	A	C	2: 69,483,385	V2334G	probably benign	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Map3k21	A	T	8: 125,924,042	H261L	probably benign	Het
Meis1	G	T	11: 18,881,679	P453Q	probably damaging	Het
Mettl16	G	T	11: 74,802,929	M255I	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mpp5	T	C	12: 78,809,922	F180L	possibly damaging	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Nav2	A	G	7: 49,464,580	I771V	probably benign	Het
Nisch	A	T	14: 31,177,285		probably benign	Het
Npc1	G	A	18: 12,196,556	P990L	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1378	A	T	11: 50,969,320	I101F	probably damaging	Het
Olfr1402	C	A	3: 97,410,449	C244F	probably damaging	Het
Olfr183	T	C	16: 59,000,420	L245P	possibly damaging	Het
Otogl	T	C	10: 107,858,918	D823G	probably benign	Het
P2rx7	A	G	5: 122,681,266	T584A	probably benign	Het
Pank1	T	A	19: 34,841,086	I18F	probably damaging	Het
Pgap3	A	G	11: 98,391,107	L126P	probably damaging	Het
Phka1	C	T	X: 102,610,201	R290H	probably damaging	Het
Pkd2	G	A	5: 104,483,176	E489K	probably damaging	Het
Prdm16	T	A	4: 154,347,925	S296C	probably null	Het
Prex2	T	A	1: 11,186,713	N1216K	probably damaging	Het
Prmt7	A	G	8: 106,227,298	T124A	probably damaging	Het
Ptpra	G	T	2: 130,539,735	R372L	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rap2b	G	T	3: 61,365,091	G12V	probably damaging	Het
Rapgef5	T	A	12: 117,714,064		probably null	Het
Rassf4	A	G	6: 116,645,127	F168S	possibly damaging	Het
Rtf1	T	A	2: 119,705,518	H184Q	probably benign	Het
Sacs	A	G	14: 61,213,771	K4422R	probably benign	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Sema3d	C	T	5: 12,563,273	T439I	probably benign	Het
Sephs1	A	G	2: 4,899,540	N243S	probably benign	Het
Setd2	TTGGGA	T	9: 110,604,144		probably null	Het
Setx	A	G	2: 29,130,301	D100G	probably benign	Het
Slc22a7	C	A	17: 46,433,972	V383L	possibly damaging	Het
Slc25a40	T	C	5: 8,430,417	C56R	probably damaging	Het
Stk38l	T	A	6: 146,768,846	L229I	probably damaging	Het
Sult2a5	T	C	7: 13,625,434	S112P	probably damaging	Het
Syt4	A	G	18: 31,440,467	Y332H	probably damaging	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Tlr9	A	G	9: 106,225,337	N609S	probably damaging	Het
Tmem120a	A	T	5: 135,736,123	S266T	possibly damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem8	C	T	17: 26,117,884	L259F	possibly damaging	Het
Tnfrsf18	T	A	4: 156,028,516	V196E	probably damaging	Het
Trpc1	A	T	9: 95,717,584	L474H	probably damaging	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp47	T	A	7: 112,067,236		probably null	Het
Vgll1	A	C	X: 57,092,430	K53T	probably damaging	Het
Vmn1r26	T	C	6: 58,008,350	N285D	possibly damaging	Het
Zfp445	T	A	9: 122,853,437	K480*	probably null	Het
Zfp786	A	G	6: 47,826,997	V37A	probably damaging	Het
Zfp821	A	G	8: 109,721,219	E64G	probably damaging	Het
Zfp994	T	A	17: 22,200,981	D329V	probably damaging	Het
Zkscan8	T	C	13: 21,520,318	S484G	probably damaging	Het

Other mutations in Gcn1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00869:Gcn1l1	APN	5	115588143	splice site	probably benign
IGL00974:Gcn1l1	APN	5	115613793	missense	possibly damaging	0.88
IGL01566:Gcn1l1	APN	5	115611058	missense	probably damaging	1.00
IGL01843:Gcn1l1	APN	5	115619700	missense	probably damaging	1.00
IGL01885:Gcn1l1	APN	5	115576115	splice site	probably null
IGL02081:Gcn1l1	APN	5	115585871	missense	probably damaging	1.00
IGL02118:Gcn1l1	APN	5	115610879	missense	probably damaging	1.00
IGL02150:Gcn1l1	APN	5	115609868	missense	probably damaging	1.00
IGL02190:Gcn1l1	APN	5	115614124	missense	probably damaging	1.00
IGL02219:Gcn1l1	APN	5	115613767	missense	possibly damaging	0.68
IGL02507:Gcn1l1	APN	5	115585881	missense	probably benign	0.11
IGL02644:Gcn1l1	APN	5	115575191	missense	probably benign
IGL02678:Gcn1l1	APN	5	115613755	missense	probably damaging	0.99
IGL02748:Gcn1l1	APN	5	115610800	splice site	probably null
IGL02755:Gcn1l1	APN	5	115604006	splice site	probably null
IGL02896:Gcn1l1	APN	5	115619648	splice site	probably benign
cusp	UTSW	5	115611060	missense	probably damaging	1.00
farthing	UTSW	5	115576108	splice site	probably benign
IGL03147:Gcn1l1	UTSW	5	115610858	missense	possibly damaging	0.78
R0362:Gcn1l1	UTSW	5	115576108	splice site	probably benign
R0540:Gcn1l1	UTSW	5	115588956	missense	probably benign	0.00
R0569:Gcn1l1	UTSW	5	115595059	missense	probably benign	0.00
R0570:Gcn1l1	UTSW	5	115592421	missense	probably damaging	1.00
R0584:Gcn1l1	UTSW	5	115595015	missense	probably damaging	1.00
R0630:Gcn1l1	UTSW	5	115581089	missense	probably benign	0.06
R0656:Gcn1l1	UTSW	5	115589303	missense	probably benign	0.27
R0801:Gcn1l1	UTSW	5	115591006	missense	probably benign	0.12
R0890:Gcn1l1	UTSW	5	115579793	missense	possibly damaging	0.77
R1400:Gcn1l1	UTSW	5	115614161	missense	probably damaging	1.00
R1485:Gcn1l1	UTSW	5	115574617	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1574:Gcn1l1	UTSW	5	115615552	missense	probably benign
R1673:Gcn1l1	UTSW	5	115582297	missense	probably benign
R1894:Gcn1l1	UTSW	5	115589115	missense	probably damaging	1.00
R2114:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2116:Gcn1l1	UTSW	5	115598825	missense	probably benign	0.35
R2152:Gcn1l1	UTSW	5	115609829	missense	probably benign	0.07
R2162:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R2216:Gcn1l1	UTSW	5	115593661	missense	probably benign
R2218:Gcn1l1	UTSW	5	115619661	missense	probably benign	0.04
R2278:Gcn1l1	UTSW	5	115611175	missense	probably damaging	1.00
R2280:Gcn1l1	UTSW	5	115612730	missense	probably damaging	1.00
R3719:Gcn1l1	UTSW	5	115579817	missense	probably benign	0.03
R3729:Gcn1l1	UTSW	5	115583394	splice site	probably benign
R3833:Gcn1l1	UTSW	5	115592132	missense	probably benign	0.18
R3932:Gcn1l1	UTSW	5	115587834	missense	probably benign	0.11
R4067:Gcn1l1	UTSW	5	115599088	missense	probably damaging	1.00
R4152:Gcn1l1	UTSW	5	115613354	critical splice acceptor site	probably null
R4179:Gcn1l1	UTSW	5	115588050	missense	probably benign	0.00
R4292:Gcn1l1	UTSW	5	115576148	missense	possibly damaging	0.49
R4350:Gcn1l1	UTSW	5	115603330	missense	probably damaging	1.00
R4493:Gcn1l1	UTSW	5	115594144	missense	probably benign
R4672:Gcn1l1	UTSW	5	115606520	missense	probably damaging	1.00
R4749:Gcn1l1	UTSW	5	115614402	missense	probably benign
R4753:Gcn1l1	UTSW	5	115616478	missense	probably benign
R4826:Gcn1l1	UTSW	5	115593693	missense	probably benign
R4873:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4875:Gcn1l1	UTSW	5	115576170	missense	possibly damaging	0.92
R4932:Gcn1l1	UTSW	5	115592144	missense	probably benign	0.00
R4992:Gcn1l1	UTSW	5	115599166	missense	probably benign	0.29
R5049:Gcn1l1	UTSW	5	115606671	missense	probably damaging	1.00
R5211:Gcn1l1	UTSW	5	115619312	missense	probably benign	0.04
R5226:Gcn1l1	UTSW	5	115588067	missense	probably benign	0.01
R5338:Gcn1l1	UTSW	5	115583403	missense	probably benign	0.00
R5914:Gcn1l1	UTSW	5	115610135	synonymous	silent
R5932:Gcn1l1	UTSW	5	115592376	missense	possibly damaging	0.77
R6422:Gcn1l1	UTSW	5	115609544	missense	probably damaging	1.00
R6435:Gcn1l1	UTSW	5	115611022	critical splice acceptor site	probably null
R6607:Gcn1l1	UTSW	5	115609478	missense	probably damaging	0.98
R6724:Gcn1l1	UTSW	5	115609158	splice site	probably null
R6861:Gcn1l1	UTSW	5	115611049	missense	probably benign
R6875:Gcn1l1	UTSW	5	115588110	missense	probably damaging	1.00
R6910:Gcn1l1	UTSW	5	115606538	missense	probably benign	0.42
R6975:Gcn1l1	UTSW	5	115613459	missense	probably damaging	1.00
R7027:Gcn1l1	UTSW	5	115616546	critical splice donor site	probably null
R7038:Gcn1l1	UTSW	5	115611144	missense	probably damaging	1.00
R7171:Gcn1l1	UTSW	5	115590293	missense	probably benign	0.02
R7276:Gcn1l1	UTSW	5	115611060	missense	probably damaging	1.00
R7456:Gcn1l1	UTSW	5	115604946	nonsense	probably null
R7473:Gcn1l1	UTSW	5	115581804	missense	probably benign	0.09
R7517:Gcn1l1	UTSW	5	115619696	missense	probably benign	0.01
R7714:Gcn1l1	UTSW	5	115595300	missense	probably damaging	0.97
R7752:Gcn1l1	UTSW	5	115615568	missense	probably damaging	1.00
R7812:Gcn1l1	UTSW	5	115593692	missense	possibly damaging	0.91
R7922:Gcn1l1	UTSW	5	115614468	missense	probably benign
R8070:Gcn1l1	UTSW	5	115588998	missense	probably benign	0.09
R8218:Gcn1l1	UTSW	5	115581529	missense	probably benign	0.00
R8329:Gcn1l1	UTSW	5	115609862	missense	probably damaging	0.99
R8413:Gcn1l1	UTSW	5	115579639	missense	probably benign	0.00
R8795:Gcn1l1	UTSW	5	115614395	missense	probably benign	0.02
R8802:Gcn1l1	UTSW	5	115609883	missense	probably damaging	1.00
R8899:Gcn1l1	UTSW	5	115579161	missense	probably benign	0.04
R8946:Gcn1l1	UTSW	5	115595345	missense	probably benign	0.02
R8963:Gcn1l1	UTSW	5	115589094	missense	probably benign	0.25
R9006:Gcn1l1	UTSW	5	115581507	missense	probably benign	0.22
R9163:Gcn1l1	UTSW	5	115604885	missense	probably benign
R9177:Gcn1l1	UTSW	5	115581808	missense	probably benign	0.35
R9187:Gcn1l1	UTSW	5	115614118	missense	probably damaging	1.00
R9411:Gcn1l1	UTSW	5	115595039	missense	possibly damaging	0.87
R9541:Gcn1l1	UTSW	5	115616357	missense	probably benign	0.00
R9574:Gcn1l1	UTSW	5	115575282	missense	possibly damaging	0.89
R9630:Gcn1l1	UTSW	5	115603290	missense	probably damaging	0.99
R9651:Gcn1l1	UTSW	5	115609606	critical splice donor site	probably null
R9761:Gcn1l1	UTSW	5	115591005	missense	probably benign	0.05
R9765:Gcn1l1	UTSW	5	115597072	nonsense	probably null
Z1177:Gcn1l1	UTSW	5	115614149	missense	probably damaging	0.99
Z1191:Gcn1l1	UTSW	5	115575293	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AATTGTCCTCCTTCCACATGGG -3'
(R):5'- TTGACATTCTCCTGCGAAGGC -3'

Sequencing Primer
(F):5'- CTTCCACATGGGGCGCC -3'
(R):5'- GCAATGCTGCCCGCTTAC -3'

Posted On

2014-09-18