Incidental Mutation 'R2117:Vmn1r26'
ID 231063
Institutional Source Beutler Lab
Gene Symbol Vmn1r26
Ensembl Gene ENSMUSG00000048697
Gene Name vomeronasal 1 receptor 26
Synonyms V1rc17
MMRRC Submission 040121-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2117 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 57985168-57986187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57985335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 285 (N285D)
Ref Sequence ENSEMBL: ENSMUSP00000154463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049694] [ENSMUST00000228040] [ENSMUST00000228070] [ENSMUST00000228951]
AlphaFold Q8R2D7
Predicted Effect possibly damaging
Transcript: ENSMUST00000049694
AA Change: N285D

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052301
Gene: ENSMUSG00000048697
AA Change: N285D

DomainStartEndE-ValueType
Pfam:V1R 28 293 5.8e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228040
AA Change: N285D

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228070
AA Change: N285D

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228951
AA Change: N285D

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,640,656 (GRCm39) C3357S probably benign Het
Ago1 T A 4: 126,357,650 (GRCm39) probably null Het
Akap10 A T 11: 61,781,129 (GRCm39) D562E possibly damaging Het
Akr1b7 G A 6: 34,395,929 (GRCm39) A144T possibly damaging Het
Ankle1 A G 8: 71,860,562 (GRCm39) T340A probably benign Het
Arf5 C T 6: 28,424,783 (GRCm39) Q71* probably null Het
Arl15 C T 13: 114,104,196 (GRCm39) S111F probably damaging Het
Asph G A 4: 9,517,671 (GRCm39) Q468* probably null Het
Bcam G T 7: 19,492,352 (GRCm39) A581E possibly damaging Het
Blvra G T 2: 126,927,989 (GRCm39) E80* probably null Het
Ccr6 T C 17: 8,474,914 (GRCm39) F40L possibly damaging Het
Cfap161 A T 7: 83,425,184 (GRCm39) N302K possibly damaging Het
Ckmt2 T A 13: 92,003,964 (GRCm39) I345F probably benign Het
Cpsf6 A G 10: 117,202,025 (GRCm39) probably benign Het
Ctnna1 A G 18: 35,285,678 (GRCm39) N8S possibly damaging Het
Cyp2d11 A G 15: 82,275,954 (GRCm39) L209P probably damaging Het
Dab2 T C 15: 6,465,096 (GRCm39) V628A probably damaging Het
Dcstamp C T 15: 39,618,571 (GRCm39) Q327* probably null Het
Defb38 A T 8: 19,073,483 (GRCm39) Y63* probably null Het
Dlg5 A T 14: 24,227,826 (GRCm39) L365* probably null Het
Dnai7 C T 6: 145,150,967 (GRCm39) probably null Het
Dnmt3l C A 10: 77,899,130 (GRCm39) L110I probably damaging Het
Exoc3l2 G T 7: 19,228,907 (GRCm39) L108F possibly damaging Het
Exoc4 T A 6: 33,324,760 (GRCm39) N351K possibly damaging Het
Fam83h C A 15: 75,876,582 (GRCm39) E252* probably null Het
Fancm A G 12: 65,123,948 (GRCm39) D202G probably damaging Het
Fat1 T A 8: 45,490,500 (GRCm39) V3804E probably benign Het
Fbxw28 T C 9: 109,159,985 (GRCm39) T190A probably benign Het
Fer1l4 T C 2: 155,881,038 (GRCm39) T843A probably benign Het
Fnip1 A T 11: 54,391,450 (GRCm39) H461L probably damaging Het
Gcn1 A T 5: 115,736,884 (GRCm39) M1276L probably benign Het
Gemin4 A G 11: 76,101,827 (GRCm39) V978A possibly damaging Het
Gm7247 A T 14: 51,602,792 (GRCm39) I43F probably damaging Het
Gm9978 C T 10: 78,322,731 (GRCm39) noncoding transcript Het
Gpr4 T C 7: 18,957,070 (GRCm39) S331P probably damaging Het
Hspa1a T A 17: 35,189,455 (GRCm39) N483Y probably damaging Het
Ift74 A G 4: 94,515,496 (GRCm39) T138A probably benign Het
Ints14 T G 9: 64,887,077 (GRCm39) L336R probably damaging Het
Irak1 G T X: 73,066,218 (GRCm39) P197Q possibly damaging Het
Kif4 A G X: 99,709,323 (GRCm39) S315G probably benign Het
L3mbtl1 T A 2: 162,801,990 (GRCm39) probably null Het
Lamb3 A G 1: 193,016,489 (GRCm39) R657G probably benign Het
Ldc1 C A 4: 130,109,156 (GRCm39) V295L possibly damaging Het
Lrp2 A C 2: 69,313,729 (GRCm39) V2334G probably benign Het
Lrwd1 T A 5: 136,159,332 (GRCm39) Y431F probably damaging Het
Map3k21 A T 8: 126,650,781 (GRCm39) H261L probably benign Het
Meis1 G T 11: 18,831,679 (GRCm39) P453Q probably damaging Het
Mettl16 G T 11: 74,693,755 (GRCm39) M255I probably benign Het
Mllt10 A G 2: 18,167,380 (GRCm39) N435S probably benign Het
Mta2 T C 19: 8,920,880 (GRCm39) I27T probably damaging Het
Nav2 A G 7: 49,114,328 (GRCm39) I771V probably benign Het
Nisch A T 14: 30,899,242 (GRCm39) probably benign Het
Npc1 G A 18: 12,329,613 (GRCm39) P990L probably damaging Het
Nrxn1 A T 17: 91,011,705 (GRCm39) I308K probably damaging Het
Or13l2 C A 3: 97,317,765 (GRCm39) C244F probably damaging Het
Or1ad6 A T 11: 50,860,147 (GRCm39) I101F probably damaging Het
Or5h17 T C 16: 58,820,783 (GRCm39) L245P possibly damaging Het
Otogl T C 10: 107,694,779 (GRCm39) D823G probably benign Het
P2rx7 A G 5: 122,819,329 (GRCm39) T584A probably benign Het
Pals1 T C 12: 78,856,696 (GRCm39) F180L possibly damaging Het
Pank1 T A 19: 34,818,486 (GRCm39) I18F probably damaging Het
Pgap3 A G 11: 98,281,933 (GRCm39) L126P probably damaging Het
Pgap6 C T 17: 26,336,858 (GRCm39) L259F possibly damaging Het
Phka1 C T X: 101,653,807 (GRCm39) R290H probably damaging Het
Pkd2 G A 5: 104,631,042 (GRCm39) E489K probably damaging Het
Prdm16 T A 4: 154,432,382 (GRCm39) S296C probably null Het
Prex2 T A 1: 11,256,937 (GRCm39) N1216K probably damaging Het
Prmt7 A G 8: 106,953,930 (GRCm39) T124A probably damaging Het
Ptpra G T 2: 130,381,655 (GRCm39) R372L probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rap2b G T 3: 61,272,512 (GRCm39) G12V probably damaging Het
Rapgef5 T A 12: 117,677,799 (GRCm39) probably null Het
Rassf4 A G 6: 116,622,088 (GRCm39) F168S possibly damaging Het
Rtf1 T A 2: 119,535,999 (GRCm39) H184Q probably benign Het
Sacs A G 14: 61,451,220 (GRCm39) K4422R probably benign Het
Sec11c A T 18: 65,933,720 (GRCm39) T9S probably benign Het
Sema3d C T 5: 12,613,240 (GRCm39) T439I probably benign Het
Sephs1 A G 2: 4,904,351 (GRCm39) N243S probably benign Het
Setd2 TTGGGA T 9: 110,433,212 (GRCm39) probably null Het
Setx A G 2: 29,020,313 (GRCm39) D100G probably benign Het
Slc22a7 C A 17: 46,744,898 (GRCm39) V383L possibly damaging Het
Slc25a40 T C 5: 8,480,417 (GRCm39) C56R probably damaging Het
Stk38l T A 6: 146,670,344 (GRCm39) L229I probably damaging Het
Sult2a5 T C 7: 13,359,359 (GRCm39) S112P probably damaging Het
Syt4 A G 18: 31,573,520 (GRCm39) Y332H probably damaging Het
Tcof1 T C 18: 60,965,857 (GRCm39) E415G possibly damaging Het
Tenm2 A G 11: 35,915,681 (GRCm39) L1951P probably damaging Het
Tlr9 A G 9: 106,102,536 (GRCm39) N609S probably damaging Het
Tmem120a A T 5: 135,764,977 (GRCm39) S266T possibly damaging Het
Tmem132b A G 5: 125,699,615 (GRCm39) E92G probably damaging Het
Tnfrsf18 T A 4: 156,112,973 (GRCm39) V196E probably damaging Het
Trpc1 A T 9: 95,599,637 (GRCm39) L474H probably damaging Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Usp20 T A 2: 30,906,317 (GRCm39) C562S probably damaging Het
Usp47 T A 7: 111,666,443 (GRCm39) probably null Het
Vgll1 A C X: 56,137,790 (GRCm39) K53T probably damaging Het
Zfp445 T A 9: 122,682,502 (GRCm39) K480* probably null Het
Zfp786 A G 6: 47,803,931 (GRCm39) V37A probably damaging Het
Zfp821 A G 8: 110,447,851 (GRCm39) E64G probably damaging Het
Zfp994 T A 17: 22,419,962 (GRCm39) D329V probably damaging Het
Zkscan8 T C 13: 21,704,488 (GRCm39) S484G probably damaging Het
Other mutations in Vmn1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Vmn1r26 APN 6 57,986,127 (GRCm39) missense possibly damaging 0.81
IGL02609:Vmn1r26 APN 6 57,985,860 (GRCm39) missense probably damaging 1.00
R1121:Vmn1r26 UTSW 6 57,985,647 (GRCm39) missense probably benign 0.43
R1881:Vmn1r26 UTSW 6 57,985,650 (GRCm39) missense probably benign 0.20
R1958:Vmn1r26 UTSW 6 57,985,286 (GRCm39) missense probably benign 0.01
R1978:Vmn1r26 UTSW 6 57,986,111 (GRCm39) missense possibly damaging 0.83
R2106:Vmn1r26 UTSW 6 57,985,710 (GRCm39) missense possibly damaging 0.69
R2323:Vmn1r26 UTSW 6 57,985,842 (GRCm39) missense probably damaging 1.00
R4917:Vmn1r26 UTSW 6 57,985,808 (GRCm39) missense probably damaging 0.99
R5695:Vmn1r26 UTSW 6 57,985,738 (GRCm39) missense probably damaging 1.00
R6355:Vmn1r26 UTSW 6 57,985,536 (GRCm39) missense probably benign 0.02
R6948:Vmn1r26 UTSW 6 57,985,718 (GRCm39) missense probably damaging 0.98
R7114:Vmn1r26 UTSW 6 57,985,755 (GRCm39) missense probably benign 0.02
R7977:Vmn1r26 UTSW 6 57,985,264 (GRCm39) nonsense probably null
R7987:Vmn1r26 UTSW 6 57,985,264 (GRCm39) nonsense probably null
R8311:Vmn1r26 UTSW 6 57,985,518 (GRCm39) missense probably benign 0.39
R8442:Vmn1r26 UTSW 6 57,985,728 (GRCm39) missense possibly damaging 0.95
R8784:Vmn1r26 UTSW 6 57,985,440 (GRCm39) missense possibly damaging 0.50
R9129:Vmn1r26 UTSW 6 57,985,373 (GRCm39) missense
RF020:Vmn1r26 UTSW 6 57,985,705 (GRCm39) missense probably benign 0.35
Z1176:Vmn1r26 UTSW 6 57,985,582 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGATCCTGGGAGTGTTAG -3'
(R):5'- TAGCATCAATTACTGGAGAGCATC -3'

Sequencing Primer
(F):5'- CTAAGATCCTGGGAGTGTTAGTGGAC -3'
(R):5'- GAGCATCTCCTGAGAAAAAGGCC -3'
Posted On 2014-09-18