Mutagenetix > Incidental Mutations

Incidental Mutation 'R2117:Setd2'

231093

Institutional Source

Beutler Lab

Gene Symbol

Setd2

Ensembl Gene

ENSMUSG00000044791

Gene Name

SET domain containing 2

Synonyms

4921524K10Rik, KMT3A

MMRRC Submission

040121-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R2117 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

110532597-110618633 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TTGGGA to T at 110604144 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153838] [ENSMUST00000197399]

Predicted Effect

probably null
Transcript: ENSMUST00000153838

SMART Domains

Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
low complexity region	156	176	N/A	INTRINSIC
low complexity region	185	207	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	392	419	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	867	883	N/A	INTRINSIC
low complexity region	1015	1039	N/A	INTRINSIC
low complexity region	1066	1077	N/A	INTRINSIC
low complexity region	1384	1395	N/A	INTRINSIC
AWS	1468	1523	8.39e-30	SMART
SET	1524	1647	3.07e-41	SMART
PostSET	1648	1664	1.27e-5	SMART
Blast:SET	1689	1714	2e-6	BLAST
low complexity region	1884	1909	N/A	INTRINSIC
low complexity region	1956	1967	N/A	INTRINSIC
coiled coil region	2090	2113	N/A	INTRINSIC
low complexity region	2189	2211	N/A	INTRINSIC
low complexity region	2248	2265	N/A	INTRINSIC
WW	2363	2395	2.1e-11	SMART
Pfam:SRI	2440	2530	6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196814

Predicted Effect

probably null
Transcript: ENSMUST00000197399

SMART Domains

Protein: ENSMUSP00000142572
Gene: ENSMUSG00000044791

Domain	Start	End	E-Value	Type
WW	7	39	2.1e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198697

Predicted Effect

probably null
Transcript: ENSMUST00000200460

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,492,537	C3357S	probably benign	Het
Ago1	T	A	4: 126,463,857		probably null	Het
Akap10	A	T	11: 61,890,303	D562E	possibly damaging	Het
Akr1b7	G	A	6: 34,418,994	A144T	possibly damaging	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Arf5	C	T	6: 28,424,784	Q71*	probably null	Het
Arl15	C	T	13: 113,967,660	S111F	probably damaging	Het
Asph	G	A	4: 9,517,671	Q468*	probably null	Het
Bcam	G	T	7: 19,758,427	A581E	possibly damaging	Het
Blvra	G	T	2: 127,086,069	E80*	probably null	Het
Casc1	C	T	6: 145,205,241		probably null	Het
Ccr6	T	C	17: 8,256,082	F40L	possibly damaging	Het
Cfap161	A	T	7: 83,775,976	N302K	possibly damaging	Het
Ckmt2	T	A	13: 91,855,845	I345F	probably benign	Het
Cpsf6	A	G	10: 117,366,120		probably benign	Het
Ctnna1	A	G	18: 35,152,625	N8S	possibly damaging	Het
Cyp2d11	A	G	15: 82,391,753	L209P	probably damaging	Het
Dab2	T	C	15: 6,435,615	V628A	probably damaging	Het
Dcstamp	C	T	15: 39,755,175	Q327*	probably null	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dlg5	A	T	14: 24,177,758	L365*	probably null	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Exoc3l2	G	T	7: 19,494,982	L108F	possibly damaging	Het
Exoc4	T	A	6: 33,347,825	N351K	possibly damaging	Het
Fam83h	C	A	15: 76,004,733	E252*	probably null	Het
Fancm	A	G	12: 65,077,174	D202G	probably damaging	Het
Fat1	T	A	8: 45,037,463	V3804E	probably benign	Het
Fbxw28	T	C	9: 109,330,917	T190A	probably benign	Het
Fer1l4	T	C	2: 156,039,118	T843A	probably benign	Het
Fnip1	A	T	11: 54,500,624	H461L	probably damaging	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gemin4	A	G	11: 76,211,001	V978A	possibly damaging	Het
Gm7247	A	T	14: 51,365,335	I43F	probably damaging	Het
Gm853	C	A	4: 130,215,363	V295L	possibly damaging	Het
Gm9978	C	T	10: 78,486,897		noncoding transcript	Het
Gpr4	T	C	7: 19,223,145	S331P	probably damaging	Het
Hspa1a	T	A	17: 34,970,479	N483Y	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ints14	T	G	9: 64,979,795	L336R	probably damaging	Het
Irak1	G	T	X: 74,022,612	P197Q	possibly damaging	Het
Kif4	A	G	X: 100,665,717	S315G	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lamb3	A	G	1: 193,334,181	R657G	probably benign	Het
Lrp2	A	C	2: 69,483,385	V2334G	probably benign	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Map3k21	A	T	8: 125,924,042	H261L	probably benign	Het
Meis1	G	T	11: 18,881,679	P453Q	probably damaging	Het
Mettl16	G	T	11: 74,802,929	M255I	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mpp5	T	C	12: 78,809,922	F180L	possibly damaging	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Nav2	A	G	7: 49,464,580	I771V	probably benign	Het
Nisch	A	T	14: 31,177,285		probably benign	Het
Npc1	G	A	18: 12,196,556	P990L	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1378	A	T	11: 50,969,320	I101F	probably damaging	Het
Olfr1402	C	A	3: 97,410,449	C244F	probably damaging	Het
Olfr183	T	C	16: 59,000,420	L245P	possibly damaging	Het
Otogl	T	C	10: 107,858,918	D823G	probably benign	Het
P2rx7	A	G	5: 122,681,266	T584A	probably benign	Het
Pank1	T	A	19: 34,841,086	I18F	probably damaging	Het
Pgap3	A	G	11: 98,391,107	L126P	probably damaging	Het
Phka1	C	T	X: 102,610,201	R290H	probably damaging	Het
Pkd2	G	A	5: 104,483,176	E489K	probably damaging	Het
Prdm16	T	A	4: 154,347,925	S296C	probably null	Het
Prex2	T	A	1: 11,186,713	N1216K	probably damaging	Het
Prmt7	A	G	8: 106,227,298	T124A	probably damaging	Het
Ptpra	G	T	2: 130,539,735	R372L	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rap2b	G	T	3: 61,365,091	G12V	probably damaging	Het
Rapgef5	T	A	12: 117,714,064		probably null	Het
Rassf4	A	G	6: 116,645,127	F168S	possibly damaging	Het
Rtf1	T	A	2: 119,705,518	H184Q	probably benign	Het
Sacs	A	G	14: 61,213,771	K4422R	probably benign	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Sema3d	C	T	5: 12,563,273	T439I	probably benign	Het
Sephs1	A	G	2: 4,899,540	N243S	probably benign	Het
Setx	A	G	2: 29,130,301	D100G	probably benign	Het
Slc22a7	C	A	17: 46,433,972	V383L	possibly damaging	Het
Slc25a40	T	C	5: 8,430,417	C56R	probably damaging	Het
Stk38l	T	A	6: 146,768,846	L229I	probably damaging	Het
Sult2a5	T	C	7: 13,625,434	S112P	probably damaging	Het
Syt4	A	G	18: 31,440,467	Y332H	probably damaging	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Tlr9	A	G	9: 106,225,337	N609S	probably damaging	Het
Tmem120a	A	T	5: 135,736,123	S266T	possibly damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem8	C	T	17: 26,117,884	L259F	possibly damaging	Het
Tnfrsf18	T	A	4: 156,028,516	V196E	probably damaging	Het
Trpc1	A	T	9: 95,717,584	L474H	probably damaging	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp47	T	A	7: 112,067,236		probably null	Het
Vgll1	A	C	X: 57,092,430	K53T	probably damaging	Het
Vmn1r26	T	C	6: 58,008,350	N285D	possibly damaging	Het
Zfp445	T	A	9: 122,853,437	K480*	probably null	Het
Zfp786	A	G	6: 47,826,997	V37A	probably damaging	Het
Zfp821	A	G	8: 109,721,219	E64G	probably damaging	Het
Zfp994	T	A	17: 22,200,981	D329V	probably damaging	Het
Zkscan8	T	C	13: 21,520,318	S484G	probably damaging	Het

Other mutations in Setd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Setd2	APN	9	110551136	missense	possibly damaging	0.94
IGL01023:Setd2	APN	9	110547513	nonsense	probably null
IGL01063:Setd2	APN	9	110573673	missense	probably damaging	1.00
IGL01745:Setd2	APN	9	110594711	missense	probably damaging	0.99
IGL01911:Setd2	APN	9	110617431	splice site	probably null
IGL01955:Setd2	APN	9	110549318	missense	probably benign	0.38
IGL02023:Setd2	APN	9	110594636	missense	probably benign	0.06
IGL02080:Setd2	APN	9	110547450	unclassified	probably null
IGL02412:Setd2	APN	9	110550774	missense	probably benign	0.00
IGL02519:Setd2	APN	9	110553116	missense	probably damaging	0.97
IGL02631:Setd2	APN	9	110550576	missense	possibly damaging	0.80
IGL02754:Setd2	APN	9	110550056	missense	possibly damaging	0.77
IGL02828:Setd2	APN	9	110561214	missense	probably benign	0.31
IGL03033:Setd2	APN	9	110551275	missense	possibly damaging	0.96
IGL03140:Setd2	APN	9	110614952	critical splice donor site	probably null
IGL03378:Setd2	APN	9	110553152	missense	unknown
American_samoa	UTSW	9	110567758	nonsense	probably null
slingshot	UTSW	9	110549507	missense	probably benign	0.00
P0028:Setd2	UTSW	9	110573954	missense	probably benign	0.00
PIT4544001:Setd2	UTSW	9	110551164	missense	probably damaging	1.00
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0167:Setd2	UTSW	9	110573782	missense	probably damaging	1.00
R0408:Setd2	UTSW	9	110594242	missense	probably damaging	1.00
R0452:Setd2	UTSW	9	110553100	splice site	probably null
R0541:Setd2	UTSW	9	110573673	missense	probably damaging	1.00
R0947:Setd2	UTSW	9	110548511	missense	possibly damaging	0.87
R1249:Setd2	UTSW	9	110573880	missense	probably damaging	0.99
R1294:Setd2	UTSW	9	110549507	missense	probably benign	0.00
R1518:Setd2	UTSW	9	110602238	missense	probably damaging	0.98
R1585:Setd2	UTSW	9	110551396	missense	unknown
R1647:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1649:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1651:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1652:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1673:Setd2	UTSW	9	110604180	missense	probably damaging	0.97
R1703:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1706:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1709:Setd2	UTSW	9	110549857	missense	probably benign	0.00
R1752:Setd2	UTSW	9	110594605	missense	probably damaging	1.00
R1796:Setd2	UTSW	9	110550345	missense	probably benign	0.01
R1796:Setd2	UTSW	9	110617816	critical splice acceptor site	probably null
R1812:Setd2	UTSW	9	110550102	missense	probably damaging	0.99
R1884:Setd2	UTSW	9	110556418	critical splice donor site	probably null
R2024:Setd2	UTSW	9	110549133	missense	possibly damaging	0.65
R2051:Setd2	UTSW	9	110550890	missense	probably benign
R2120:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2124:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2172:Setd2	UTSW	9	110549844	missense	probably benign	0.10
R2179:Setd2	UTSW	9	110594688	nonsense	probably null
R2262:Setd2	UTSW	9	110561243	intron	probably benign
R2411:Setd2	UTSW	9	110550429	missense	possibly damaging	0.46
R2413:Setd2	UTSW	9	110547504	missense	probably damaging	1.00
R2419:Setd2	UTSW	9	110548997	missense	possibly damaging	0.48
R2424:Setd2	UTSW	9	110617522	missense	probably benign	0.37
R3757:Setd2	UTSW	9	110573685	missense	probably damaging	0.99
R3765:Setd2	UTSW	9	110594246	missense	probably damaging	1.00
R3796:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3797:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3799:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3899:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3900:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3913:Setd2	UTSW	9	110551046	missense	probably damaging	0.99
R4010:Setd2	UTSW	9	110599195	missense	probably null	1.00
R4580:Setd2	UTSW	9	110574243	missense	probably benign	0.06
R4614:Setd2	UTSW	9	110569813	critical splice donor site	probably null
R4651:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4652:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4855:Setd2	UTSW	9	110571954	missense	probably benign	0.02
R4970:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5112:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5123:Setd2	UTSW	9	110617527	missense	possibly damaging	0.76
R5140:Setd2	UTSW	9	110551129	missense	probably benign	0.00
R5202:Setd2	UTSW	9	110551230	missense	probably damaging	1.00
R5290:Setd2	UTSW	9	110617831	missense	probably damaging	1.00
R5560:Setd2	UTSW	9	110549839	nonsense	probably null
R5604:Setd2	UTSW	9	110604216	missense	probably damaging	0.99
R5678:Setd2	UTSW	9	110602186	missense	probably damaging	0.99
R5708:Setd2	UTSW	9	110548823	missense	possibly damaging	0.59
R5763:Setd2	UTSW	9	110556275	splice site	probably null
R5814:Setd2	UTSW	9	110567758	nonsense	probably null
R5924:Setd2	UTSW	9	110574044	missense	probably benign	0.23
R6244:Setd2	UTSW	9	110548665	missense	probably damaging	1.00
R6313:Setd2	UTSW	9	110556366	missense	unknown
R6431:Setd2	UTSW	9	110550385	missense	possibly damaging	0.65
R6526:Setd2	UTSW	9	110532717	missense	probably benign	0.33
R6579:Setd2	UTSW	9	110549778	missense	possibly damaging	0.87
R6996:Setd2	UTSW	9	110550572	missense	probably damaging	0.99
R7012:Setd2	UTSW	9	110547683	missense	probably damaging	0.97
R7105:Setd2	UTSW	9	110548260	missense	probably damaging	1.00
R7134:Setd2	UTSW	9	110548797	missense	possibly damaging	0.87
R7222:Setd2	UTSW	9	110551462	missense
R7359:Setd2	UTSW	9	110562944	missense
R7492:Setd2	UTSW	9	110594632	missense

Predicted Primers

PCR Primer
(F):5'- ATTGCTGAGGAGAAGCTATCAG -3'
(R):5'- CTGGTATGTTTCCTGCATATATGTC -3'

Sequencing Primer
(F):5'- CAGGGCTGTCTGTTACTTT -3'
(R):5'- AGGCAGTTGTAACCTGTCAC -3'

Posted On

2014-09-18