Mutagenetix > Incidental Mutation

Incidental Mutation 'R2117:Adgrv1'

231115

Institutional Source

Beutler Lab

Gene Symbol

Adgrv1

Ensembl Gene

ENSMUSG00000069170

Gene Name

adhesion G protein-coupled receptor V1

Synonyms

Mass1, Mgr1, VLGR1, Gpr98

MMRRC Submission

040121-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81095068-81633154 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81492537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 3357 (C3357S)

Ref Sequence

ENSEMBL: ENSMUSP00000093245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095585]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000095585
AA Change: C3357S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: C3357S

Domain	Start	End	E-Value	Type
Calx_beta	20	116	1.53e-1	SMART
Calx_beta	132	236	1.58e-2	SMART
Calx_beta	251	362	2.33e-2	SMART
Pfam:Calx-beta	380	489	1.1e-3	PFAM
Pfam:Calx-beta	507	616	2.5e-2	PFAM
Pfam:Calx-beta	667	747	9.1e-4	PFAM
Calx_beta	764	862	1.55e-1	SMART
Calx_beta	877	980	1.07e-1	SMART
Calx_beta	994	1094	6.45e-5	SMART
Pfam:Calx-beta	1108	1208	7.4e-4	PFAM
Pfam:Laminin_G_3	1331	1492	4.4e-24	PFAM
Pfam:Calx-beta	1498	1542	6.5e-3	PFAM
Pfam:Calx-beta	1557	1662	1e-6	PFAM
Calx_beta	1706	1805	1.34e-11	SMART
Calx_beta	1846	1948	1.04e-2	SMART
Calx_beta	1962	2075	1.59e-3	SMART
Calx_beta	2103	2202	1.59e-4	SMART
Calx_beta	2218	2320	1.74e-3	SMART
Pfam:Calx-beta	2467	2539	2.1e-4	PFAM
Calx_beta	2576	2672	1.24e-6	SMART
Calx_beta	2687	2786	1.12e-1	SMART
Calx_beta	2810	2921	2.21e-2	SMART
Calx_beta	2945	3044	6.69e-12	SMART
Pfam:Calx-beta	3063	3168	1.2e-5	PFAM
Pfam:Calx-beta	3198	3252	1.2e-1	PFAM
Pfam:EPTP	3391	3434	2.8e-10	PFAM
Pfam:Calx-beta	3577	3623	6.5e-8	PFAM
Pfam:Calx-beta	3637	3737	6e-4	PFAM
Pfam:Calx-beta	3781	3872	6.9e-3	PFAM
Calx_beta	3919	4003	1.18e-2	SMART
Calx_beta	4017	4120	5.44e-2	SMART
Pfam:Calx-beta	4193	4236	2.3e-2	PFAM
Calx_beta	4251	4351	1.43e-20	SMART
Calx_beta	4384	4484	9.46e-3	SMART
Pfam:Calx-beta	4498	4608	2e-2	PFAM
Pfam:Calx-beta	4659	4729	5.1e-2	PFAM
Calx_beta	4989	5089	5.7e-6	SMART
Pfam:Calx-beta	5229	5326	1.9e-6	PFAM
Pfam:Calx-beta	5489	5592	7.2e-5	PFAM
low complexity region	5637	5648	N/A	INTRINSIC
GPS	5845	5895	9.48e-3	SMART
Pfam:7tm_2	5902	6141	2.3e-16	PFAM
low complexity region	6227	6240	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	T	A	4: 126,463,857		probably null	Het
Akap10	A	T	11: 61,890,303	D562E	possibly damaging	Het
Akr1b7	G	A	6: 34,418,994	A144T	possibly damaging	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Arf5	C	T	6: 28,424,784	Q71*	probably null	Het
Arl15	C	T	13: 113,967,660	S111F	probably damaging	Het
Asph	G	A	4: 9,517,671	Q468*	probably null	Het
Bcam	G	T	7: 19,758,427	A581E	possibly damaging	Het
Blvra	G	T	2: 127,086,069	E80*	probably null	Het
Casc1	C	T	6: 145,205,241		probably null	Het
Ccr6	T	C	17: 8,256,082	F40L	possibly damaging	Het
Cfap161	A	T	7: 83,775,976	N302K	possibly damaging	Het
Ckmt2	T	A	13: 91,855,845	I345F	probably benign	Het
Cpsf6	A	G	10: 117,366,120		probably benign	Het
Ctnna1	A	G	18: 35,152,625	N8S	possibly damaging	Het
Cyp2d11	A	G	15: 82,391,753	L209P	probably damaging	Het
Dab2	T	C	15: 6,435,615	V628A	probably damaging	Het
Dcstamp	C	T	15: 39,755,175	Q327*	probably null	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dlg5	A	T	14: 24,177,758	L365*	probably null	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Exoc3l2	G	T	7: 19,494,982	L108F	possibly damaging	Het
Exoc4	T	A	6: 33,347,825	N351K	possibly damaging	Het
Fam83h	C	A	15: 76,004,733	E252*	probably null	Het
Fancm	A	G	12: 65,077,174	D202G	probably damaging	Het
Fat1	T	A	8: 45,037,463	V3804E	probably benign	Het
Fbxw28	T	C	9: 109,330,917	T190A	probably benign	Het
Fer1l4	T	C	2: 156,039,118	T843A	probably benign	Het
Fnip1	A	T	11: 54,500,624	H461L	probably damaging	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gemin4	A	G	11: 76,211,001	V978A	possibly damaging	Het
Gm7247	A	T	14: 51,365,335	I43F	probably damaging	Het
Gm853	C	A	4: 130,215,363	V295L	possibly damaging	Het
Gm9978	C	T	10: 78,486,897		noncoding transcript	Het
Gpr4	T	C	7: 19,223,145	S331P	probably damaging	Het
Hspa1a	T	A	17: 34,970,479	N483Y	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ints14	T	G	9: 64,979,795	L336R	probably damaging	Het
Irak1	G	T	X: 74,022,612	P197Q	possibly damaging	Het
Kif4	A	G	X: 100,665,717	S315G	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lamb3	A	G	1: 193,334,181	R657G	probably benign	Het
Lrp2	A	C	2: 69,483,385	V2334G	probably benign	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Map3k21	A	T	8: 125,924,042	H261L	probably benign	Het
Meis1	G	T	11: 18,881,679	P453Q	probably damaging	Het
Mettl16	G	T	11: 74,802,929	M255I	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mpp5	T	C	12: 78,809,922	F180L	possibly damaging	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Nav2	A	G	7: 49,464,580	I771V	probably benign	Het
Nisch	A	T	14: 31,177,285		probably benign	Het
Npc1	G	A	18: 12,196,556	P990L	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1378	A	T	11: 50,969,320	I101F	probably damaging	Het
Olfr1402	C	A	3: 97,410,449	C244F	probably damaging	Het
Olfr183	T	C	16: 59,000,420	L245P	possibly damaging	Het
Otogl	T	C	10: 107,858,918	D823G	probably benign	Het
P2rx7	A	G	5: 122,681,266	T584A	probably benign	Het
Pank1	T	A	19: 34,841,086	I18F	probably damaging	Het
Pgap3	A	G	11: 98,391,107	L126P	probably damaging	Het
Phka1	C	T	X: 102,610,201	R290H	probably damaging	Het
Pkd2	G	A	5: 104,483,176	E489K	probably damaging	Het
Prdm16	T	A	4: 154,347,925	S296C	probably null	Het
Prex2	T	A	1: 11,186,713	N1216K	probably damaging	Het
Prmt7	A	G	8: 106,227,298	T124A	probably damaging	Het
Ptpra	G	T	2: 130,539,735	R372L	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rap2b	G	T	3: 61,365,091	G12V	probably damaging	Het
Rapgef5	T	A	12: 117,714,064		probably null	Het
Rassf4	A	G	6: 116,645,127	F168S	possibly damaging	Het
Rtf1	T	A	2: 119,705,518	H184Q	probably benign	Het
Sacs	A	G	14: 61,213,771	K4422R	probably benign	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Sema3d	C	T	5: 12,563,273	T439I	probably benign	Het
Sephs1	A	G	2: 4,899,540	N243S	probably benign	Het
Setd2	TTGGGA	T	9: 110,604,144		probably null	Het
Setx	A	G	2: 29,130,301	D100G	probably benign	Het
Slc22a7	C	A	17: 46,433,972	V383L	possibly damaging	Het
Slc25a40	T	C	5: 8,430,417	C56R	probably damaging	Het
Stk38l	T	A	6: 146,768,846	L229I	probably damaging	Het
Sult2a5	T	C	7: 13,625,434	S112P	probably damaging	Het
Syt4	A	G	18: 31,440,467	Y332H	probably damaging	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Tlr9	A	G	9: 106,225,337	N609S	probably damaging	Het
Tmem120a	A	T	5: 135,736,123	S266T	possibly damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem8	C	T	17: 26,117,884	L259F	possibly damaging	Het
Tnfrsf18	T	A	4: 156,028,516	V196E	probably damaging	Het
Trpc1	A	T	9: 95,717,584	L474H	probably damaging	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp47	T	A	7: 112,067,236		probably null	Het
Vgll1	A	C	X: 57,092,430	K53T	probably damaging	Het
Vmn1r26	T	C	6: 58,008,350	N285D	possibly damaging	Het
Zfp445	T	A	9: 122,853,437	K480*	probably null	Het
Zfp786	A	G	6: 47,826,997	V37A	probably damaging	Het
Zfp821	A	G	8: 109,721,219	E64G	probably damaging	Het
Zfp994	T	A	17: 22,200,981	D329V	probably damaging	Het
Zkscan8	T	C	13: 21,520,318	S484G	probably damaging	Het

Other mutations in Adgrv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgrv1	APN	13	81405408	critical splice acceptor site	probably null
IGL00090:Adgrv1	APN	13	81578101	missense	probably damaging	1.00
IGL00091:Adgrv1	APN	13	81578101	missense	probably damaging	1.00
IGL00332:Adgrv1	APN	13	81472877	splice site	probably benign
IGL00471:Adgrv1	APN	13	81509542	missense	probably damaging	0.99
IGL00476:Adgrv1	APN	13	81489074	missense	probably damaging	0.98
IGL00508:Adgrv1	APN	13	81506187	missense	probably damaging	1.00
IGL00727:Adgrv1	APN	13	81524684	missense	probably damaging	0.98
IGL00781:Adgrv1	APN	13	81578230	missense	probably benign	0.19
IGL00816:Adgrv1	APN	13	81397203	missense	probably benign	0.01
IGL00844:Adgrv1	APN	13	81540119	missense	probably damaging	1.00
IGL00923:Adgrv1	APN	13	81382291	missense	probably damaging	0.99
IGL01113:Adgrv1	APN	13	81489028	missense	probably benign	0.00
IGL01143:Adgrv1	APN	13	81419351	missense	probably benign	0.00
IGL01151:Adgrv1	APN	13	81405399	missense	probably benign	0.00
IGL01153:Adgrv1	APN	13	81419128	missense	probably benign	0.01
IGL01363:Adgrv1	APN	13	81557065	missense	probably damaging	1.00
IGL01419:Adgrv1	APN	13	81557158	missense	probably damaging	0.99
IGL01545:Adgrv1	APN	13	81466184	missense	possibly damaging	0.46
IGL01701:Adgrv1	APN	13	81419631	missense	possibly damaging	0.55
IGL01796:Adgrv1	APN	13	81567342	missense	probably benign	0.01
IGL01816:Adgrv1	APN	13	81529049	missense	probably benign	0.00
IGL01871:Adgrv1	APN	13	81472394	critical splice donor site	probably null
IGL01955:Adgrv1	APN	13	81182783	missense	probably damaging	1.00
IGL01956:Adgrv1	APN	13	81446430	missense	possibly damaging	0.63
IGL01988:Adgrv1	APN	13	81557309	missense	probably damaging	0.99
IGL01990:Adgrv1	APN	13	81556996	missense	probably damaging	1.00
IGL02007:Adgrv1	APN	13	81568743	splice site	probably benign
IGL02016:Adgrv1	APN	13	81397453	missense	probably damaging	1.00
IGL02095:Adgrv1	APN	13	81579790	missense	possibly damaging	0.63
IGL02174:Adgrv1	APN	13	81427664	missense	probably benign	0.34
IGL02270:Adgrv1	APN	13	81559195	splice site	probably null
IGL02328:Adgrv1	APN	13	81578175	missense	probably damaging	1.00
IGL02350:Adgrv1	APN	13	81270855	missense	probably benign	0.00
IGL02357:Adgrv1	APN	13	81270855	missense	probably benign	0.00
IGL02373:Adgrv1	APN	13	81459713	missense	possibly damaging	0.90
IGL02402:Adgrv1	APN	13	81559424	missense	probably benign	0.18
IGL02407:Adgrv1	APN	13	81479670	missense	probably damaging	1.00
IGL02508:Adgrv1	APN	13	81435556	splice site	probably benign
IGL02603:Adgrv1	APN	13	81488952	missense	possibly damaging	0.93
IGL02648:Adgrv1	APN	13	81511619	missense	probably benign	0.35
IGL02720:Adgrv1	APN	13	81578872	missense	probably damaging	0.99
IGL02870:Adgrv1	APN	13	81563732	missense	probably benign	0.13
IGL02896:Adgrv1	APN	13	81520739	missense	probably damaging	1.00
IGL02931:Adgrv1	APN	13	81579714	missense	probably damaging	1.00
IGL02952:Adgrv1	APN	13	81433636	missense	probably benign	0.00
IGL02961:Adgrv1	APN	13	81523612	missense	probably damaging	1.00
IGL02999:Adgrv1	APN	13	81578854	missense	probably benign	0.12
IGL03067:Adgrv1	APN	13	81442480	missense	probably damaging	1.00
IGL03106:Adgrv1	APN	13	81472899	missense	probably benign	0.00
IGL03108:Adgrv1	APN	13	81559529	missense	probably damaging	1.00
IGL03119:Adgrv1	APN	13	81382373	missense	probably damaging	1.00
IGL03119:Adgrv1	APN	13	81433700	missense	probably benign	0.02
IGL03169:Adgrv1	APN	13	81503900	missense	probably damaging	1.00
IGL03186:Adgrv1	APN	13	81433618	missense	possibly damaging	0.80
IGL03196:Adgrv1	APN	13	81446478	missense	probably benign	0.02
IGL03207:Adgrv1	APN	13	81106898	splice site	probably null
IGL03343:Adgrv1	APN	13	81283388	missense	probably damaging	1.00
IGL03348:Adgrv1	APN	13	81499058	missense	possibly damaging	0.54
IGL03349:Adgrv1	APN	13	81481336	missense	probably benign	0.09
IGL03373:Adgrv1	APN	13	81563632	missense	probably damaging	0.99
IGL03381:Adgrv1	APN	13	81517967	missense	probably damaging	0.99
abetting	UTSW	13	81579560	missense	probably damaging	1.00
beatle	UTSW	13	81579594	nonsense	probably null
Escape	UTSW	13	81435705	missense	probably benign	0.02
lento	UTSW	13	81270897	missense	probably damaging	1.00
Metronome	UTSW	13	81435559	critical splice donor site	probably null
Murderous	UTSW	13	81103324	missense	possibly damaging	0.94
Nome	UTSW	13	81391767	missense	probably benign	0.00
Propulsion	UTSW	13	81475047	missense	probably benign	0.06
revulsion	UTSW	13	81595182	missense	probably damaging	1.00
Saturnv	UTSW	13	81531676	missense	probably damaging	1.00
Thrust	UTSW	13	81374256	missense	probably benign	0.01
Velocity	UTSW	13	81397354	missense	probably benign	0.00
Wilting	UTSW	13	81492501	missense	probably benign	0.02
Withering	UTSW	13	81494657	missense	probably damaging	1.00
F2404:Adgrv1	UTSW	13	81420006	missense	probably benign	0.13
G1patch:Adgrv1	UTSW	13	81437557	missense	probably damaging	0.99
G1patch:Adgrv1	UTSW	13	81493210	missense	probably damaging	1.00
I2288:Adgrv1	UTSW	13	81437524	missense	probably damaging	1.00
I2289:Adgrv1	UTSW	13	81437524	missense	probably damaging	1.00
PIT4377001:Adgrv1	UTSW	13	81528985	missense	probably damaging	1.00
PIT4504001:Adgrv1	UTSW	13	81559352	missense	probably damaging	0.99
R0017:Adgrv1	UTSW	13	81578946	missense	probably benign	0.13
R0017:Adgrv1	UTSW	13	81578946	missense	probably benign	0.13
R0058:Adgrv1	UTSW	13	81182672	missense	possibly damaging	0.65
R0058:Adgrv1	UTSW	13	81182672	missense	possibly damaging	0.65
R0083:Adgrv1	UTSW	13	81578404	unclassified	probably benign
R0087:Adgrv1	UTSW	13	81386951	missense	probably damaging	1.00
R0108:Adgrv1	UTSW	13	81578404	unclassified	probably benign
R0131:Adgrv1	UTSW	13	81502995	unclassified	probably benign
R0218:Adgrv1	UTSW	13	81106898	splice site	probably null
R0325:Adgrv1	UTSW	13	81540015	missense	probably damaging	1.00
R0326:Adgrv1	UTSW	13	81474993	missense	possibly damaging	0.46
R0395:Adgrv1	UTSW	13	81385953	missense	probably benign	0.00
R0441:Adgrv1	UTSW	13	81397226	nonsense	probably null
R0466:Adgrv1	UTSW	13	81566296	missense	probably benign	0.00
R0487:Adgrv1	UTSW	13	81489035	missense	probably damaging	1.00
R0501:Adgrv1	UTSW	13	81559150	missense	probably damaging	1.00
R0522:Adgrv1	UTSW	13	81528442	splice site	probably benign
R0532:Adgrv1	UTSW	13	81578896	missense	probably damaging	1.00
R0542:Adgrv1	UTSW	13	81573318	missense	probably damaging	1.00
R0681:Adgrv1	UTSW	13	81528530	missense	probably damaging	1.00
R0689:Adgrv1	UTSW	13	81475105	missense	possibly damaging	0.47
R0732:Adgrv1	UTSW	13	81503004	missense	possibly damaging	0.86
R0746:Adgrv1	UTSW	13	81570556	missense	probably benign	0.10
R0763:Adgrv1	UTSW	13	81499125	missense	probably damaging	0.98
R0846:Adgrv1	UTSW	13	81479742	nonsense	probably null
R0962:Adgrv1	UTSW	13	81405346	missense	probably benign	0.01
R1146:Adgrv1	UTSW	13	81531676	missense	probably damaging	1.00
R1146:Adgrv1	UTSW	13	81531676	missense	probably damaging	1.00
R1172:Adgrv1	UTSW	13	81557063	missense	probably damaging	0.98
R1178:Adgrv1	UTSW	13	81440037	splice site	probably benign
R1310:Adgrv1	UTSW	13	81566377	missense	probably benign	0.09
R1386:Adgrv1	UTSW	13	81528865	missense	probably benign	0.17
R1387:Adgrv1	UTSW	13	81493176	missense	possibly damaging	0.62
R1395:Adgrv1	UTSW	13	81386788	missense	probably benign	0.05
R1412:Adgrv1	UTSW	13	81095450	missense	probably damaging	1.00
R1448:Adgrv1	UTSW	13	81433513	missense	probably benign	0.08
R1470:Adgrv1	UTSW	13	81382298	missense	probably benign	0.03
R1470:Adgrv1	UTSW	13	81382298	missense	probably benign	0.03
R1485:Adgrv1	UTSW	13	81579619	missense	probably damaging	1.00
R1507:Adgrv1	UTSW	13	81472580	critical splice acceptor site	probably null
R1513:Adgrv1	UTSW	13	81556957	missense	probably damaging	1.00
R1513:Adgrv1	UTSW	13	81593048	missense	probably damaging	1.00
R1539:Adgrv1	UTSW	13	81503978	splice site	probably null
R1579:Adgrv1	UTSW	13	81563779	missense	probably damaging	1.00
R1580:Adgrv1	UTSW	13	81466160	critical splice donor site	probably null
R1611:Adgrv1	UTSW	13	81559117	missense	probably damaging	1.00
R1615:Adgrv1	UTSW	13	81424288	missense	probably benign	0.41
R1651:Adgrv1	UTSW	13	81487853	missense	probably benign	0.19
R1660:Adgrv1	UTSW	13	81476631	missense	probably benign	0.00
R1679:Adgrv1	UTSW	13	81559552	missense	probably damaging	1.00
R1709:Adgrv1	UTSW	13	81593060	missense	probably damaging	1.00
R1735:Adgrv1	UTSW	13	81487947	missense	possibly damaging	0.62
R1762:Adgrv1	UTSW	13	81506146	missense	probably benign	0.08
R1830:Adgrv1	UTSW	13	81489077	missense	possibly damaging	0.65
R1836:Adgrv1	UTSW	13	81504113	missense	probably benign	0.01
R1843:Adgrv1	UTSW	13	81544533	missense	probably damaging	1.00
R1863:Adgrv1	UTSW	13	81563566	missense	probably damaging	1.00
R1895:Adgrv1	UTSW	13	81374249	missense	probably damaging	1.00
R1907:Adgrv1	UTSW	13	81592551	splice site	probably benign
R1928:Adgrv1	UTSW	13	81520786	missense	probably benign	0.00
R1938:Adgrv1	UTSW	13	81391757	missense	probably damaging	0.99
R1944:Adgrv1	UTSW	13	81510911	missense	probably damaging	1.00
R1946:Adgrv1	UTSW	13	81374249	missense	probably damaging	1.00
R1984:Adgrv1	UTSW	13	81523749	missense	probably damaging	1.00
R2027:Adgrv1	UTSW	13	81595182	missense	probably damaging	1.00
R2063:Adgrv1	UTSW	13	81561469	missense	possibly damaging	0.81
R2116:Adgrv1	UTSW	13	81529013	missense	probably benign	0.11
R2125:Adgrv1	UTSW	13	81419535	missense	probably benign	0.00
R2125:Adgrv1	UTSW	13	81419950	missense	probably benign	0.02
R2127:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2128:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2129:Adgrv1	UTSW	13	81557080	missense	probably damaging	1.00
R2130:Adgrv1	UTSW	13	81581727	missense	possibly damaging	0.61
R2135:Adgrv1	UTSW	13	81524557	critical splice donor site	probably null
R2138:Adgrv1	UTSW	13	81445320	missense	probably benign	0.00
R2166:Adgrv1	UTSW	13	81568643	missense	probably damaging	1.00
R2171:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R2191:Adgrv1	UTSW	13	81566290	missense	possibly damaging	0.90
R2256:Adgrv1	UTSW	13	81506140	missense	probably benign
R2260:Adgrv1	UTSW	13	81568374	missense	probably damaging	0.97
R2323:Adgrv1	UTSW	13	81595179	missense	probably damaging	1.00
R2432:Adgrv1	UTSW	13	81540132	frame shift	probably null
R2910:Adgrv1	UTSW	13	81557119	missense	possibly damaging	0.61
R2920:Adgrv1	UTSW	13	81448865	missense	probably benign	0.01
R2989:Adgrv1	UTSW	13	81581747	missense	probably damaging	1.00
R3402:Adgrv1	UTSW	13	81543542	missense	probably damaging	1.00
R3692:Adgrv1	UTSW	13	81524600	missense	possibly damaging	0.91
R3711:Adgrv1	UTSW	13	81419475	missense	probably benign	0.02
R3732:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3732:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3733:Adgrv1	UTSW	13	81556956	missense	probably damaging	1.00
R3773:Adgrv1	UTSW	13	81499043	missense	probably damaging	0.98
R3791:Adgrv1	UTSW	13	81593102	missense	probably damaging	1.00
R3794:Adgrv1	UTSW	13	81283367	start codon destroyed	probably damaging	1.00
R3848:Adgrv1	UTSW	13	81440072	missense	probably damaging	0.97
R3880:Adgrv1	UTSW	13	81435705	missense	probably benign	0.02
R3925:Adgrv1	UTSW	13	81578772	missense	possibly damaging	0.89
R3934:Adgrv1	UTSW	13	81475047	missense	probably benign	0.06
R3942:Adgrv1	UTSW	13	81182789	missense	probably damaging	1.00
R4002:Adgrv1	UTSW	13	81540132	frame shift	probably null
R4003:Adgrv1	UTSW	13	81540132	frame shift	probably null
R4194:Adgrv1	UTSW	13	81498996	missense	probably damaging	0.98
R4308:Adgrv1	UTSW	13	81440192	missense	probably damaging	0.96
R4368:Adgrv1	UTSW	13	81492910	missense	unknown
R4388:Adgrv1	UTSW	13	81581709	missense	probably damaging	0.98
R4421:Adgrv1	UTSW	13	81566302	missense	probably damaging	1.00
R4468:Adgrv1	UTSW	13	81374256	missense	probably benign	0.01
R4483:Adgrv1	UTSW	13	81419230	missense	probably benign	0.01
R4487:Adgrv1	UTSW	13	81440066	missense	probably damaging	0.99
R4566:Adgrv1	UTSW	13	81419808	missense	probably damaging	1.00
R4615:Adgrv1	UTSW	13	81494569	splice site	probably null
R4647:Adgrv1	UTSW	13	81528795	nonsense	probably null
R4657:Adgrv1	UTSW	13	81405364	missense	probably benign	0.01
R4723:Adgrv1	UTSW	13	81433525	missense	probably benign	0.02
R4765:Adgrv1	UTSW	13	81106919	missense	probably damaging	0.99
R4783:Adgrv1	UTSW	13	81095445	missense	probably damaging	0.99
R4796:Adgrv1	UTSW	13	81155231	nonsense	probably null
R4816:Adgrv1	UTSW	13	81528674	missense	probably damaging	1.00
R4833:Adgrv1	UTSW	13	81560844	missense	possibly damaging	0.81
R4841:Adgrv1	UTSW	13	81503001	critical splice donor site	probably null
R4871:Adgrv1	UTSW	13	81533122	intron	probably benign
R4897:Adgrv1	UTSW	13	81561585	splice site	probably null
R4906:Adgrv1	UTSW	13	81270738	splice site	probably null
R4917:Adgrv1	UTSW	13	81510877	missense	probably benign	0.30
R4996:Adgrv1	UTSW	13	81578734	missense	probably benign	0.01
R5030:Adgrv1	UTSW	13	81459829	missense	probably benign	0.43
R5044:Adgrv1	UTSW	13	81488931	missense	probably benign	0.01
R5052:Adgrv1	UTSW	13	81528821	missense	probably damaging	0.97
R5093:Adgrv1	UTSW	13	81592585	missense	probably damaging	1.00
R5095:Adgrv1	UTSW	13	81095487	missense	probably benign	0.00
R5119:Adgrv1	UTSW	13	81419427	missense	possibly damaging	0.93
R5133:Adgrv1	UTSW	13	81439441	missense	probably damaging	1.00
R5141:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R5164:Adgrv1	UTSW	13	81435674	missense	probably benign	0.00
R5180:Adgrv1	UTSW	13	81283416	start gained	probably benign
R5203:Adgrv1	UTSW	13	81510905	missense	possibly damaging	0.91
R5241:Adgrv1	UTSW	13	81488929	nonsense	probably null
R5280:Adgrv1	UTSW	13	81397465	missense	possibly damaging	0.95
R5289:Adgrv1	UTSW	13	81521084	missense	probably benign	0.04
R5304:Adgrv1	UTSW	13	81578253	missense	possibly damaging	0.93
R5310:Adgrv1	UTSW	13	81476690	missense	possibly damaging	0.95
R5338:Adgrv1	UTSW	13	81529046	missense	possibly damaging	0.80
R5352:Adgrv1	UTSW	13	81494657	missense	probably damaging	1.00
R5402:Adgrv1	UTSW	13	81459715	missense	probably benign	0.25
R5418:Adgrv1	UTSW	13	81419308	missense	probably benign	0.01
R5460:Adgrv1	UTSW	13	81424258	missense	possibly damaging	0.95
R5510:Adgrv1	UTSW	13	81445244	missense	probably damaging	1.00
R5521:Adgrv1	UTSW	13	81419389	missense	probably benign	0.01
R5538:Adgrv1	UTSW	13	81433689	missense	probably benign	0.02
R5561:Adgrv1	UTSW	13	81476564	missense	probably damaging	0.99
R5584:Adgrv1	UTSW	13	81405267	missense	probably damaging	1.00
R5608:Adgrv1	UTSW	13	81155276	missense	probably damaging	1.00
R5610:Adgrv1	UTSW	13	81521117	missense	probably damaging	1.00
R5619:Adgrv1	UTSW	13	81472500	missense	probably damaging	1.00
R5751:Adgrv1	UTSW	13	81522236	missense	probably damaging	1.00
R5832:Adgrv1	UTSW	13	81103302	missense	possibly damaging	0.95
R5885:Adgrv1	UTSW	13	81424271	missense	probably benign	0.15
R5930:Adgrv1	UTSW	13	81397451	missense	probably benign	0.06
R5937:Adgrv1	UTSW	13	81107075	missense	probably damaging	0.96
R5943:Adgrv1	UTSW	13	81386866	missense	probably damaging	0.98
R5951:Adgrv1	UTSW	13	81442501	missense	probably damaging	1.00
R5977:Adgrv1	UTSW	13	81435559	critical splice donor site	probably null
R5995:Adgrv1	UTSW	13	81466259	missense	probably benign	0.03
R6017:Adgrv1	UTSW	13	81397423	nonsense	probably null
R6024:Adgrv1	UTSW	13	81476505	missense	probably benign	0.26
R6049:Adgrv1	UTSW	13	81397354	missense	probably benign	0.00
R6108:Adgrv1	UTSW	13	81391695	missense	probably damaging	0.99
R6130:Adgrv1	UTSW	13	81427745	missense	probably damaging	0.99
R6132:Adgrv1	UTSW	13	81506076	missense	probably benign	0.04
R6149:Adgrv1	UTSW	13	81182774	missense	probably damaging	1.00
R6169:Adgrv1	UTSW	13	81419259	missense	probably benign	0.00
R6175:Adgrv1	UTSW	13	81386005	missense	probably damaging	1.00
R6184:Adgrv1	UTSW	13	81433838	missense	probably benign	0.01
R6190:Adgrv1	UTSW	13	81459763	splice site	probably null
R6190:Adgrv1	UTSW	13	81524779	splice site	probably null
R6215:Adgrv1	UTSW	13	81579594	nonsense	probably null
R6216:Adgrv1	UTSW	13	81524471	splice site	probably null
R6238:Adgrv1	UTSW	13	81466283	missense	probably benign	0.07
R6244:Adgrv1	UTSW	13	81106931	missense	probably damaging	1.00
R6298:Adgrv1	UTSW	13	81391767	missense	probably benign	0.00
R6316:Adgrv1	UTSW	13	81499068	missense	possibly damaging	0.63
R6336:Adgrv1	UTSW	13	81385981	missense	probably benign	0.09
R6358:Adgrv1	UTSW	13	81414583	missense	probably damaging	0.99
R6421:Adgrv1	UTSW	13	81508736	missense	possibly damaging	0.69
R6466:Adgrv1	UTSW	13	81575101	splice site	probably null
R6467:Adgrv1	UTSW	13	81444538	missense	probably benign	0.01
R6510:Adgrv1	UTSW	13	81559490	missense	possibly damaging	0.88
R6519:Adgrv1	UTSW	13	81567343	missense	probably benign	0.01
R6521:Adgrv1	UTSW	13	81433652	missense	probably damaging	1.00
R6598:Adgrv1	UTSW	13	81506179	missense	probably damaging	1.00
R6605:Adgrv1	UTSW	13	81487962	missense	possibly damaging	0.80
R6626:Adgrv1	UTSW	13	81518126	missense	probably damaging	1.00
R6633:Adgrv1	UTSW	13	81568643	missense	probably damaging	1.00
R6721:Adgrv1	UTSW	13	81481515	missense	probably benign	0.00
R6725:Adgrv1	UTSW	13	81437557	missense	probably damaging	0.99
R6725:Adgrv1	UTSW	13	81493210	missense	probably damaging	1.00
R6796:Adgrv1	UTSW	13	81472478	missense	probably damaging	1.00
R6809:Adgrv1	UTSW	13	81472953	missense	probably benign	0.01
R6823:Adgrv1	UTSW	13	81557081	missense	probably damaging	1.00
R6876:Adgrv1	UTSW	13	81155154	critical splice donor site	probably null
R6878:Adgrv1	UTSW	13	81433494	missense	probably benign	0.06
R6887:Adgrv1	UTSW	13	81528701	missense	probably benign	0.01
R6888:Adgrv1	UTSW	13	81508669	missense	probably damaging	1.00
R6957:Adgrv1	UTSW	13	81567490	missense	probably benign	0.00
R6976:Adgrv1	UTSW	13	81520997	missense	probably damaging	1.00
R7003:Adgrv1	UTSW	13	81522104	critical splice donor site	probably null
R7007:Adgrv1	UTSW	13	81536364	missense	possibly damaging	0.80
R7073:Adgrv1	UTSW	13	81561474	missense	probably damaging	1.00
R7100:Adgrv1	UTSW	13	81270897	missense	probably damaging	1.00
R7107:Adgrv1	UTSW	13	81578142	missense	probably benign	0.13
R7123:Adgrv1	UTSW	13	81592574	missense	probably damaging	1.00
R7141:Adgrv1	UTSW	13	81492501	missense	probably benign	0.02
R7168:Adgrv1	UTSW	13	81397209	missense	possibly damaging	0.52
R7205:Adgrv1	UTSW	13	81479658	missense	probably benign	0.00
R7239:Adgrv1	UTSW	13	81476612	missense	possibly damaging	0.69
R7249:Adgrv1	UTSW	13	81374259	missense	probably damaging	1.00
R7313:Adgrv1	UTSW	13	81520515	missense	possibly damaging	0.95
R7376:Adgrv1	UTSW	13	81518126	missense	probably damaging	1.00
R7392:Adgrv1	UTSW	13	81560689	missense	probably damaging	1.00
R7395:Adgrv1	UTSW	13	81559348	missense	probably damaging	1.00
R7410:Adgrv1	UTSW	13	81563619	missense	probably benign	0.04
R7449:Adgrv1	UTSW	13	81499073	missense	probably damaging	0.99
R7496:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7497:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7498:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7567:Adgrv1	UTSW	13	81433529	missense	probably benign	0.00
R7567:Adgrv1	UTSW	13	81579477	missense	probably damaging	1.00
R7614:Adgrv1	UTSW	13	81520661	missense	probably damaging	1.00
R7623:Adgrv1	UTSW	13	81422225	missense	possibly damaging	0.77
R7665:Adgrv1	UTSW	13	81499142	missense	probably damaging	1.00
R7685:Adgrv1	UTSW	13	81103324	missense	possibly damaging	0.94
R7788:Adgrv1	UTSW	13	81573314	missense	probably damaging	1.00
R7809:Adgrv1	UTSW	13	81528641	missense	possibly damaging	0.81
R7854:Adgrv1	UTSW	13	81593088	missense	probably damaging	1.00
R7894:Adgrv1	UTSW	13	81567451	missense	probably benign	0.00
R7948:Adgrv1	UTSW	13	81559529	missense	probably damaging	1.00
R7948:Adgrv1	UTSW	13	81559588	missense	probably damaging	1.00
R7949:Adgrv1	UTSW	13	81155234	missense	probably damaging	1.00
R7951:Adgrv1	UTSW	13	81563570	missense	probably damaging	1.00
R7968:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7969:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R7973:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8007:Adgrv1	UTSW	13	81283466	missense	probably benign	0.04
R8018:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8044:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8050:Adgrv1	UTSW	13	81413177	missense	probably damaging	1.00
R8090:Adgrv1	UTSW	13	81448834	critical splice donor site	probably null
R8104:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8122:Adgrv1	UTSW	13	81270918	missense	probably damaging	1.00
R8122:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8123:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8125:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8126:Adgrv1	UTSW	13	81440225	missense	possibly damaging	0.79
R8212:Adgrv1	UTSW	13	81522121	missense	probably benign	0.01
R8221:Adgrv1	UTSW	13	81528914	missense	probably benign	0.00
R8256:Adgrv1	UTSW	13	81579560	missense	probably damaging	1.00
R8270:Adgrv1	UTSW	13	81503044	missense	probably damaging	0.96
R8290:Adgrv1	UTSW	13	81481883	missense	probably benign	0.00
R8298:Adgrv1	UTSW	13	81385914	nonsense	probably null
R8317:Adgrv1	UTSW	13	81575117	missense	probably damaging	0.98
R8326:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8327:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8330:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8332:Adgrv1	UTSW	13	81445343	missense	probably damaging	1.00
R8345:Adgrv1	UTSW	13	81103386	missense	probably damaging	1.00
R8398:Adgrv1	UTSW	13	81182678	missense	probably damaging	1.00
R8399:Adgrv1	UTSW	13	81489170	missense	possibly damaging	0.55
R8450:Adgrv1	UTSW	13	81435843	splice site	probably null
R8471:Adgrv1	UTSW	13	81446472	missense	probably benign	0.00
R8534:Adgrv1	UTSW	13	81386768	missense	probably benign	0.02
R8537:Adgrv1	UTSW	13	81536372	missense	probably damaging	1.00
R8703:Adgrv1	UTSW	13	81528673	missense	probably damaging	1.00
R8845:Adgrv1	UTSW	13	81481359	missense	possibly damaging	0.79
R8846:Adgrv1	UTSW	13	81488906	critical splice donor site	probably null
R8849:Adgrv1	UTSW	13	81521205	missense	probably benign
R8856:Adgrv1	UTSW	13	81559502	missense	probably benign	0.11
R8915:Adgrv1	UTSW	13	81567439	missense	probably damaging	1.00
R8963:Adgrv1	UTSW	13	81419469	missense	probably benign
R8994:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8995:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8996:Adgrv1	UTSW	13	81405338	frame shift	probably null
R8997:Adgrv1	UTSW	13	81405338	frame shift	probably null
R9022:Adgrv1	UTSW	13	81155193	missense	probably damaging	1.00
R9059:Adgrv1	UTSW	13	81414573	critical splice donor site	probably null
R9076:Adgrv1	UTSW	13	81422128	critical splice donor site	probably null
R9119:Adgrv1	UTSW	13	81510876	missense	probably damaging	0.97
R9137:Adgrv1	UTSW	13	81540014	missense	probably damaging	1.00
R9146:Adgrv1	UTSW	13	81413172	missense	probably benign	0.11
R9156:Adgrv1	UTSW	13	81521183	missense	probably benign	0.00
R9163:Adgrv1	UTSW	13	81419422	missense	probably benign	0.19
R9282:Adgrv1	UTSW	13	81103372	missense	probably damaging	1.00
R9286:Adgrv1	UTSW	13	81446401	missense	probably damaging	0.98
R9328:Adgrv1	UTSW	13	81472404	missense	probably damaging	1.00
R9329:Adgrv1	UTSW	13	81499122	missense	probably damaging	1.00
R9350:Adgrv1	UTSW	13	81506155	missense	probably damaging	1.00
R9377:Adgrv1	UTSW	13	81557158	missense	probably damaging	0.99
R9394:Adgrv1	UTSW	13	81476648	missense	possibly damaging	0.95
R9419:Adgrv1	UTSW	13	81508768	missense	probably benign	0.44
R9427:Adgrv1	UTSW	13	81584115	missense	probably benign	0.00
R9429:Adgrv1	UTSW	13	81419349	missense	probably damaging	1.00
R9429:Adgrv1	UTSW	13	81593046	missense	probably damaging	0.99
R9433:Adgrv1	UTSW	13	81566352	missense	probably benign	0.02
R9434:Adgrv1	UTSW	13	81518173	splice site	probably benign
R9513:Adgrv1	UTSW	13	81382353	missense	possibly damaging	0.95
R9515:Adgrv1	UTSW	13	81543378	missense	probably damaging	0.99
R9523:Adgrv1	UTSW	13	81419059	missense
R9525:Adgrv1	UTSW	13	81445334	missense	possibly damaging	0.77
R9576:Adgrv1	UTSW	13	81543489	missense	probably benign	0.06
R9612:Adgrv1	UTSW	13	81492963	missense	probably damaging	1.00
R9664:Adgrv1	UTSW	13	81522169	missense	probably benign	0.01
R9664:Adgrv1	UTSW	13	81595252	missense	probably damaging	1.00
R9702:Adgrv1	UTSW	13	81536364	missense	possibly damaging	0.80
R9717:Adgrv1	UTSW	13	81520781	missense	probably damaging	1.00
R9720:Adgrv1	UTSW	13	81592574	missense	probably damaging	1.00
X0054:Adgrv1	UTSW	13	81559270	missense	probably damaging	1.00
X0062:Adgrv1	UTSW	13	81386926	missense	probably damaging	0.99
X0067:Adgrv1	UTSW	13	81543392	missense	possibly damaging	0.51
Z1088:Adgrv1	UTSW	13	81476672	missense	probably damaging	1.00
Z1176:Adgrv1	UTSW	13	81559634	missense	possibly damaging	0.90
Z1177:Adgrv1	UTSW	13	81419256	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- ATTAGATTGGCGCTCTCCCC -3'
(R):5'- TTGTCTCCAGCTGATATTTAGGAAC -3'

Sequencing Primer
(F):5'- CTAGTCTTCAAAAACCGTGTCC -3'
(R):5'- CCAGCTGATATTTAGGAACACATAGC -3'

Posted On

2014-09-18