Incidental Mutation 'R2117:Ckmt2'
ID 231116
Institutional Source Beutler Lab
Gene Symbol Ckmt2
Ensembl Gene ENSMUSG00000021622
Gene Name creatine kinase, mitochondrial 2
Synonyms ScCKmit, 2300008A19Rik
MMRRC Submission 040121-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R2117 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 91853387-91876885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91855845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 345 (I345F)
Ref Sequence ENSEMBL: ENSMUSP00000022122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022122]
AlphaFold Q6P8J7
Predicted Effect probably benign
Transcript: ENSMUST00000022122
AA Change: I345F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022122
Gene: ENSMUSG00000021622
AA Change: I345F

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 58 133 3.4e-35 PFAM
Pfam:ATP-gua_Ptrans 154 401 1.3e-95 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The hearts of mice homozygous for disruptions of this gene have hypertrophic and dilated left ventricles exhibit functional abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,492,537 C3357S probably benign Het
Ago1 T A 4: 126,463,857 probably null Het
Akap10 A T 11: 61,890,303 D562E possibly damaging Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Asph G A 4: 9,517,671 Q468* probably null Het
Bcam G T 7: 19,758,427 A581E possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Casc1 C T 6: 145,205,241 probably null Het
Ccr6 T C 17: 8,256,082 F40L possibly damaging Het
Cfap161 A T 7: 83,775,976 N302K possibly damaging Het
Cpsf6 A G 10: 117,366,120 probably benign Het
Ctnna1 A G 18: 35,152,625 N8S possibly damaging Het
Cyp2d11 A G 15: 82,391,753 L209P probably damaging Het
Dab2 T C 15: 6,435,615 V628A probably damaging Het
Dcstamp C T 15: 39,755,175 Q327* probably null Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dlg5 A T 14: 24,177,758 L365* probably null Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Exoc3l2 G T 7: 19,494,982 L108F possibly damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Fam83h C A 15: 76,004,733 E252* probably null Het
Fancm A G 12: 65,077,174 D202G probably damaging Het
Fat1 T A 8: 45,037,463 V3804E probably benign Het
Fbxw28 T C 9: 109,330,917 T190A probably benign Het
Fer1l4 T C 2: 156,039,118 T843A probably benign Het
Fnip1 A T 11: 54,500,624 H461L probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gemin4 A G 11: 76,211,001 V978A possibly damaging Het
Gm7247 A T 14: 51,365,335 I43F probably damaging Het
Gm853 C A 4: 130,215,363 V295L possibly damaging Het
Gm9978 C T 10: 78,486,897 noncoding transcript Het
Gpr4 T C 7: 19,223,145 S331P probably damaging Het
Hspa1a T A 17: 34,970,479 N483Y probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lamb3 A G 1: 193,334,181 R657G probably benign Het
Lrp2 A C 2: 69,483,385 V2334G probably benign Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Map3k21 A T 8: 125,924,042 H261L probably benign Het
Meis1 G T 11: 18,881,679 P453Q probably damaging Het
Mettl16 G T 11: 74,802,929 M255I probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mpp5 T C 12: 78,809,922 F180L possibly damaging Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Nav2 A G 7: 49,464,580 I771V probably benign Het
Nisch A T 14: 31,177,285 probably benign Het
Npc1 G A 18: 12,196,556 P990L probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1378 A T 11: 50,969,320 I101F probably damaging Het
Olfr1402 C A 3: 97,410,449 C244F probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Otogl T C 10: 107,858,918 D823G probably benign Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pank1 T A 19: 34,841,086 I18F probably damaging Het
Pgap3 A G 11: 98,391,107 L126P probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pkd2 G A 5: 104,483,176 E489K probably damaging Het
Prdm16 T A 4: 154,347,925 S296C probably null Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rap2b G T 3: 61,365,091 G12V probably damaging Het
Rapgef5 T A 12: 117,714,064 probably null Het
Rassf4 A G 6: 116,645,127 F168S possibly damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sacs A G 14: 61,213,771 K4422R probably benign Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sema3d C T 5: 12,563,273 T439I probably benign Het
Sephs1 A G 2: 4,899,540 N243S probably benign Het
Setd2 TTGGGA T 9: 110,604,144 probably null Het
Setx A G 2: 29,130,301 D100G probably benign Het
Slc22a7 C A 17: 46,433,972 V383L possibly damaging Het
Slc25a40 T C 5: 8,430,417 C56R probably damaging Het
Stk38l T A 6: 146,768,846 L229I probably damaging Het
Sult2a5 T C 7: 13,625,434 S112P probably damaging Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Tlr9 A G 9: 106,225,337 N609S probably damaging Het
Tmem120a A T 5: 135,736,123 S266T possibly damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem8 C T 17: 26,117,884 L259F possibly damaging Het
Tnfrsf18 T A 4: 156,028,516 V196E probably damaging Het
Trpc1 A T 9: 95,717,584 L474H probably damaging Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp47 T A 7: 112,067,236 probably null Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Vmn1r26 T C 6: 58,008,350 N285D possibly damaging Het
Zfp445 T A 9: 122,853,437 K480* probably null Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zfp821 A G 8: 109,721,219 E64G probably damaging Het
Zfp994 T A 17: 22,200,981 D329V probably damaging Het
Zkscan8 T C 13: 21,520,318 S484G probably damaging Het
Other mutations in Ckmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ckmt2 APN 13 91863263 missense probably damaging 1.00
IGL01359:Ckmt2 APN 13 91861820 missense probably damaging 1.00
IGL02138:Ckmt2 APN 13 91861828 missense probably benign 0.44
IGL02372:Ckmt2 APN 13 91865224 missense probably benign 0.02
IGL02415:Ckmt2 APN 13 91863340 splice site probably benign
IGL02714:Ckmt2 APN 13 91858308 missense possibly damaging 0.64
IGL02866:Ckmt2 APN 13 91858281 nonsense probably null
R0329:Ckmt2 UTSW 13 91863203 missense possibly damaging 0.93
R0330:Ckmt2 UTSW 13 91863203 missense possibly damaging 0.93
R0593:Ckmt2 UTSW 13 91853638 missense probably damaging 0.99
R1438:Ckmt2 UTSW 13 91859852 splice site probably benign
R1529:Ckmt2 UTSW 13 91861201 missense probably benign
R1616:Ckmt2 UTSW 13 91859209 missense probably benign 0.16
R2114:Ckmt2 UTSW 13 91855845 missense probably benign 0.05
R4300:Ckmt2 UTSW 13 91863338 critical splice acceptor site probably null
R5038:Ckmt2 UTSW 13 91861163 missense probably benign 0.01
R5322:Ckmt2 UTSW 13 91861772 missense possibly damaging 0.59
R7539:Ckmt2 UTSW 13 91859944 missense probably damaging 1.00
R8039:Ckmt2 UTSW 13 91863312 missense possibly damaging 0.94
R8189:Ckmt2 UTSW 13 91855775 missense probably damaging 0.99
R8258:Ckmt2 UTSW 13 91859216 missense probably damaging 1.00
R8259:Ckmt2 UTSW 13 91859216 missense probably damaging 1.00
R9127:Ckmt2 UTSW 13 91859218 missense probably damaging 1.00
R9231:Ckmt2 UTSW 13 91863192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGGTTATTTTCCATGCAAG -3'
(R):5'- GTTTGTTTACAGCACCAGAAAGTG -3'

Sequencing Primer
(F):5'- GGGTTATTTTCCATGCAAGAGAAAC -3'
(R):5'- CAGAAAGTGGACTTTGATGGTG -3'
Posted On 2014-09-18