Mutagenetix > Incidental Mutations

Incidental Mutation 'R2117:Ckmt2'

231116

Institutional Source

Beutler Lab

Gene Symbol

Ckmt2

Ensembl Gene

ENSMUSG00000021622

Gene Name

creatine kinase, mitochondrial 2

Synonyms

ScCKmit, 2300008A19Rik

MMRRC Submission

040121-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.416) question?

Stock #

R2117 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91853387-91876885 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91855845 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 345 (I345F)

Ref Sequence

ENSEMBL: ENSMUSP00000022122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022122]

Predicted Effect

probably benign
Transcript: ENSMUST00000022122
AA Change: I345F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000022122
Gene: ENSMUSG00000021622
AA Change: I345F

Domain	Start	End	E-Value	Type
Pfam:ATP-gua_PtransN	58	133	3.4e-35	PFAM
Pfam:ATP-gua_Ptrans	154	401	1.3e-95	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The hearts of mice homozygous for disruptions of this gene have hypertrophic and dilated left ventricles exhibit functional abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,492,537	C3357S	probably benign	Het
Ago1	T	A	4: 126,463,857		probably null	Het
Akap10	A	T	11: 61,890,303	D562E	possibly damaging	Het
Akr1b7	G	A	6: 34,418,994	A144T	possibly damaging	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Arf5	C	T	6: 28,424,784	Q71*	probably null	Het
Arl15	C	T	13: 113,967,660	S111F	probably damaging	Het
Asph	G	A	4: 9,517,671	Q468*	probably null	Het
Bcam	G	T	7: 19,758,427	A581E	possibly damaging	Het
Blvra	G	T	2: 127,086,069	E80*	probably null	Het
Casc1	C	T	6: 145,205,241		probably null	Het
Ccr6	T	C	17: 8,256,082	F40L	possibly damaging	Het
Cfap161	A	T	7: 83,775,976	N302K	possibly damaging	Het
Cpsf6	A	G	10: 117,366,120		probably benign	Het
Ctnna1	A	G	18: 35,152,625	N8S	possibly damaging	Het
Cyp2d11	A	G	15: 82,391,753	L209P	probably damaging	Het
Dab2	T	C	15: 6,435,615	V628A	probably damaging	Het
Dcstamp	C	T	15: 39,755,175	Q327*	probably null	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dlg5	A	T	14: 24,177,758	L365*	probably null	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Exoc3l2	G	T	7: 19,494,982	L108F	possibly damaging	Het
Exoc4	T	A	6: 33,347,825	N351K	possibly damaging	Het
Fam83h	C	A	15: 76,004,733	E252*	probably null	Het
Fancm	A	G	12: 65,077,174	D202G	probably damaging	Het
Fat1	T	A	8: 45,037,463	V3804E	probably benign	Het
Fbxw28	T	C	9: 109,330,917	T190A	probably benign	Het
Fer1l4	T	C	2: 156,039,118	T843A	probably benign	Het
Fnip1	A	T	11: 54,500,624	H461L	probably damaging	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gemin4	A	G	11: 76,211,001	V978A	possibly damaging	Het
Gm7247	A	T	14: 51,365,335	I43F	probably damaging	Het
Gm853	C	A	4: 130,215,363	V295L	possibly damaging	Het
Gm9978	C	T	10: 78,486,897		noncoding transcript	Het
Gpr4	T	C	7: 19,223,145	S331P	probably damaging	Het
Hspa1a	T	A	17: 34,970,479	N483Y	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ints14	T	G	9: 64,979,795	L336R	probably damaging	Het
Irak1	G	T	X: 74,022,612	P197Q	possibly damaging	Het
Kif4	A	G	X: 100,665,717	S315G	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lamb3	A	G	1: 193,334,181	R657G	probably benign	Het
Lrp2	A	C	2: 69,483,385	V2334G	probably benign	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Map3k21	A	T	8: 125,924,042	H261L	probably benign	Het
Meis1	G	T	11: 18,881,679	P453Q	probably damaging	Het
Mettl16	G	T	11: 74,802,929	M255I	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mpp5	T	C	12: 78,809,922	F180L	possibly damaging	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Nav2	A	G	7: 49,464,580	I771V	probably benign	Het
Nisch	A	T	14: 31,177,285		probably benign	Het
Npc1	G	A	18: 12,196,556	P990L	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1378	A	T	11: 50,969,320	I101F	probably damaging	Het
Olfr1402	C	A	3: 97,410,449	C244F	probably damaging	Het
Olfr183	T	C	16: 59,000,420	L245P	possibly damaging	Het
Otogl	T	C	10: 107,858,918	D823G	probably benign	Het
P2rx7	A	G	5: 122,681,266	T584A	probably benign	Het
Pank1	T	A	19: 34,841,086	I18F	probably damaging	Het
Pgap3	A	G	11: 98,391,107	L126P	probably damaging	Het
Phka1	C	T	X: 102,610,201	R290H	probably damaging	Het
Pkd2	G	A	5: 104,483,176	E489K	probably damaging	Het
Prdm16	T	A	4: 154,347,925	S296C	probably null	Het
Prex2	T	A	1: 11,186,713	N1216K	probably damaging	Het
Prmt7	A	G	8: 106,227,298	T124A	probably damaging	Het
Ptpra	G	T	2: 130,539,735	R372L	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rap2b	G	T	3: 61,365,091	G12V	probably damaging	Het
Rapgef5	T	A	12: 117,714,064		probably null	Het
Rassf4	A	G	6: 116,645,127	F168S	possibly damaging	Het
Rtf1	T	A	2: 119,705,518	H184Q	probably benign	Het
Sacs	A	G	14: 61,213,771	K4422R	probably benign	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Sema3d	C	T	5: 12,563,273	T439I	probably benign	Het
Sephs1	A	G	2: 4,899,540	N243S	probably benign	Het
Setd2	TTGGGA	T	9: 110,604,144		probably null	Het
Setx	A	G	2: 29,130,301	D100G	probably benign	Het
Slc22a7	C	A	17: 46,433,972	V383L	possibly damaging	Het
Slc25a40	T	C	5: 8,430,417	C56R	probably damaging	Het
Stk38l	T	A	6: 146,768,846	L229I	probably damaging	Het
Sult2a5	T	C	7: 13,625,434	S112P	probably damaging	Het
Syt4	A	G	18: 31,440,467	Y332H	probably damaging	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Tlr9	A	G	9: 106,225,337	N609S	probably damaging	Het
Tmem120a	A	T	5: 135,736,123	S266T	possibly damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem8	C	T	17: 26,117,884	L259F	possibly damaging	Het
Tnfrsf18	T	A	4: 156,028,516	V196E	probably damaging	Het
Trpc1	A	T	9: 95,717,584	L474H	probably damaging	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp47	T	A	7: 112,067,236		probably null	Het
Vgll1	A	C	X: 57,092,430	K53T	probably damaging	Het
Vmn1r26	T	C	6: 58,008,350	N285D	possibly damaging	Het
Zfp445	T	A	9: 122,853,437	K480*	probably null	Het
Zfp786	A	G	6: 47,826,997	V37A	probably damaging	Het
Zfp821	A	G	8: 109,721,219	E64G	probably damaging	Het
Zfp994	T	A	17: 22,200,981	D329V	probably damaging	Het
Zkscan8	T	C	13: 21,520,318	S484G	probably damaging	Het

Other mutations in Ckmt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Ckmt2	APN	13	91863263	missense	probably damaging	1.00
IGL01359:Ckmt2	APN	13	91861820	missense	probably damaging	1.00
IGL02138:Ckmt2	APN	13	91861828	missense	probably benign	0.44
IGL02372:Ckmt2	APN	13	91865224	missense	probably benign	0.02
IGL02415:Ckmt2	APN	13	91863340	splice site	probably benign
IGL02714:Ckmt2	APN	13	91858308	missense	possibly damaging	0.64
IGL02866:Ckmt2	APN	13	91858281	nonsense	probably null
R0329:Ckmt2	UTSW	13	91863203	missense	possibly damaging	0.93
R0330:Ckmt2	UTSW	13	91863203	missense	possibly damaging	0.93
R0593:Ckmt2	UTSW	13	91853638	missense	probably damaging	0.99
R1438:Ckmt2	UTSW	13	91859852	splice site	probably benign
R1529:Ckmt2	UTSW	13	91861201	missense	probably benign
R1616:Ckmt2	UTSW	13	91859209	missense	probably benign	0.16
R2114:Ckmt2	UTSW	13	91855845	missense	probably benign	0.05
R4300:Ckmt2	UTSW	13	91863338	critical splice acceptor site	probably null
R5038:Ckmt2	UTSW	13	91861163	missense	probably benign	0.01
R5322:Ckmt2	UTSW	13	91861772	missense	possibly damaging	0.59
R7539:Ckmt2	UTSW	13	91859944	missense	probably damaging	1.00
R8039:Ckmt2	UTSW	13	91863312	missense	possibly damaging	0.94
R8189:Ckmt2	UTSW	13	91855775	missense	probably damaging	0.99
R8258:Ckmt2	UTSW	13	91859216	missense	probably damaging	1.00
R8259:Ckmt2	UTSW	13	91859216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGGGTTATTTTCCATGCAAG -3'
(R):5'- GTTTGTTTACAGCACCAGAAAGTG -3'

Sequencing Primer
(F):5'- GGGTTATTTTCCATGCAAGAGAAAC -3'
(R):5'- CAGAAAGTGGACTTTGATGGTG -3'

Posted On

2014-09-18