Mutagenetix > Incidental Mutation

Incidental Mutation 'R2118:Kel'

231184

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

040122-MU

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R2118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41689300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 471 (I471L)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]

AlphaFold

Q9EQF2

Predicted Effect

probably benign
Transcript: ENSMUST00000031899
AA Change: I471L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: I471L

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031900

SMART Domains

Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:DUF4717	37	107	7.8e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153760

Predicted Effect

unknown
Transcript: ENSMUST00000192118
AA Change: I153L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192406

Predicted Effect

probably benign
Transcript: ENSMUST00000194597

SMART Domains

Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M13	16	68	3.6e-10	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	C	11: 83,440,364	S31P	possibly damaging	Het
4933430I17Rik	T	A	4: 62,538,872	L143M	possibly damaging	Het
Abca13	T	C	11: 9,309,013		probably benign	Het
Abcg5	T	A	17: 84,671,147	E294D	probably benign	Het
Abi3bp	T	C	16: 56,477,864		probably benign	Het
Adamts8	T	C	9: 30,943,063	F76S	probably damaging	Het
Agpat3	T	C	10: 78,278,084	R257G	probably damaging	Het
Ahctf1	C	A	1: 179,769,452	R43L	probably damaging	Het
AI593442	T	C	9: 52,677,693	T195A	probably benign	Het
Aipl1	A	T	11: 72,029,369	L291Q	possibly damaging	Het
Ambn	T	A	5: 88,460,758		probably benign	Het
Arap2	G	A	5: 62,706,685	T532I	probably damaging	Het
Arg1	T	C	10: 24,920,723	N69D	possibly damaging	Het
Arhgef10	A	G	8: 14,934,820	D200G	probably damaging	Het
Arhgef38	T	C	3: 133,160,753	K208E	probably benign	Het
Asb4	A	T	6: 5,390,687	T27S	probably benign	Het
Ash1l	C	G	3: 88,985,295	Q1494E	possibly damaging	Het
Car12	T	C	9: 66,713,892	V15A	probably benign	Het
Cdc20b	A	G	13: 113,078,698	I267V	probably benign	Het
Cdh1	A	G	8: 106,664,210	I653V	probably benign	Het
Cenpe	T	A	3: 135,246,884	M1445K	possibly damaging	Het
Cfap43	T	C	19: 47,770,438	E932G	probably damaging	Het
Cfhr1	G	C	1: 139,550,904	Q243E	probably benign	Het
Cnih2	C	A	19: 5,098,248	A6S	possibly damaging	Het
Cntnap1	G	T	11: 101,188,657	M1240I	probably benign	Het
Cntrl	T	C	2: 35,161,965	S1050P	probably benign	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Dbx2	A	C	15: 95,624,800	L342R	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dnajb2	T	C	1: 75,237,477	W30R	probably damaging	Het
Ecel1	A	G	1: 87,148,275	S727P	probably damaging	Het
Ednrb	T	A	14: 103,821,768	D274V	probably benign	Het
Fam78b	G	A	1: 167,078,709	V146M	probably damaging	Het
Fancd2	A	G	6: 113,560,074		probably benign	Het
Fbxw14	T	C	9: 109,274,624		probably benign	Het
Gimap4	G	T	6: 48,690,971	C92F	probably benign	Het
Gm5828	A	G	1: 16,769,975		noncoding transcript	Het
Gnpat	T	C	8: 124,876,941	V186A	probably damaging	Het
Gnptab	T	C	10: 88,436,398	S967P	probably benign	Het
Ikbkb	T	C	8: 22,667,217		probably benign	Het
Il1rap	A	T	16: 26,710,565	H379L	probably damaging	Het
Ints12	T	C	3: 133,109,160	V376A	probably damaging	Het
Kalrn	C	T	16: 34,332,230	S309N	possibly damaging	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Ksr1	A	T	11: 79,045,193	M77K	probably benign	Het
Leo1	T	A	9: 75,445,812	N212K	probably damaging	Het
Ltbp1	T	A	17: 75,310,159	V1031E	possibly damaging	Het
Ltbr	A	G	6: 125,309,477	S249P	probably benign	Het
Mast4	A	G	13: 102,754,205	V855A	probably damaging	Het
Mdga2	T	A	12: 66,868,752	E43V	probably damaging	Het
Mmaa	A	T	8: 79,267,959	L406*	probably null	Het
Nlrp12	A	T	7: 3,241,449	N144K	probably damaging	Het
Nlrp6	T	C	7: 140,926,444	V766A	probably benign	Het
Olfr1314	C	A	2: 112,092,330	V124L	probably benign	Het
Olfr186	A	G	16: 59,027,815	F31L	possibly damaging	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Pappa2	T	C	1: 158,857,266	T768A	probably damaging	Het
Pde6d	A	G	1: 86,545,802	F91L	probably benign	Het
Ppp1r13l	A	G	7: 19,371,421	M373V	possibly damaging	Het
Prss37	G	A	6: 40,515,360	R186*	probably null	Het
Psg16	C	A	7: 17,090,623	H111N	probably benign	Het
Psg20	T	A	7: 18,681,022	Y316F	probably benign	Het
Psmd1	T	A	1: 86,078,700	S263T	possibly damaging	Het
Rai14	A	G	15: 10,575,166	F569L	probably benign	Het
Rbpms2	T	A	9: 65,650,947	D116E	probably damaging	Het
Rgs20	A	G	1: 4,916,890		probably benign	Het
Rnf114	T	C	2: 167,510,883	L101P	probably damaging	Het
Rnf168	T	G	16: 32,278,218	L37R	probably damaging	Het
RP23-114B10.6	A	C	8: 69,372,290		noncoding transcript	Het
Rpe	T	C	1: 66,715,228	M153T	probably damaging	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Slc2a13	A	G	15: 91,516,476	V181A	probably damaging	Het
Soga1	T	C	2: 157,033,325	E835G	probably damaging	Het
Spag17	A	G	3: 100,049,240	E884G	possibly damaging	Het
Sycn	T	C	7: 28,541,288	S127P	probably damaging	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tas2r117	T	A	6: 132,803,166	I89K	probably damaging	Het
Tep1	C	A	14: 50,855,572		probably null	Het
Tex14	T	C	11: 87,519,743		probably benign	Het
Tll1	T	C	8: 64,085,557	E351G	probably benign	Het
Tmem44	T	A	16: 30,547,444	K55*	probably null	Het
Trak1	T	A	9: 121,472,997	*940R	probably null	Het
Vmn1r200	C	T	13: 22,395,183	T43I	probably damaging	Het
Wars2	T	C	3: 99,216,567	V248A	probably benign	Het
Wfdc6b	C	T	2: 164,617,443	R142C	probably benign	Het
Zfp729a	A	T	13: 67,621,494		probably null	Het
Zfp759	C	A	13: 67,139,514		probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
R9518:Kel	UTSW	6	41702400	missense	probably damaging	1.00
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATCACAGAATGCATGTGTGTAC -3'
(R):5'- TTACACGCCAACTTGAAGCC -3'

Sequencing Primer
(F):5'- TGTGAGCATATATACATGAAAGCTC -3'
(R):5'- CGCCAACTTGAAGCCATTTAAGAGG -3'

Posted On

2014-09-18