Incidental Mutation 'R0189:Gm1110'
ID23119
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0189 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26883218 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 504 (E504V)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect probably null
Transcript: ENSMUST00000115261
AA Change: E504V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: E504V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217197
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Ino80 T A 2: 119,379,679 D1377V probably benign Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Olfr923 T A 9: 38,827,815 Y41* probably null Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Phf20 A G 2: 156,303,141 S890G probably benign Het
Plk2 C T 13: 110,399,463 T567M probably damaging Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rnf17 A G 14: 56,482,193 S967G probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
R7990:Gm1110 UTSW 9 26880841 missense possibly damaging 0.66
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
R8454:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8454:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTCTTGCCTAGCAACTACACAAC -3'
(R):5'- GGATTCCCTGTTCTGAGCACTCTG -3'

Sequencing Primer
(F):5'- ACAACACAAAAATATCACAGTTTCTC -3'
(R):5'- TTGGTTCCCAGTCCCAAGAG -3'
Posted On2013-04-16