Incidental Mutation 'R2118:Nlrp6'
ID 231198
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 040122-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2118 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140506357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 766 (V766A)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably benign
Transcript: ENSMUST00000106045
AA Change: V749A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: V749A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
AA Change: V736A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: V736A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000184560
AA Change: V766A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: V766A

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Meta Mutation Damage Score 0.6903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,331,190 (GRCm39) S31P possibly damaging Het
4933430I17Rik T A 4: 62,457,109 (GRCm39) L143M possibly damaging Het
Abca13 T C 11: 9,259,013 (GRCm39) probably benign Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Abi3bp T C 16: 56,298,227 (GRCm39) probably benign Het
Adamts8 T C 9: 30,854,359 (GRCm39) F76S probably damaging Het
Agpat3 T C 10: 78,113,918 (GRCm39) R257G probably damaging Het
Ahctf1 C A 1: 179,597,017 (GRCm39) R43L probably damaging Het
AI593442 T C 9: 52,588,993 (GRCm39) T195A probably benign Het
Aipl1 A T 11: 71,920,195 (GRCm39) L291Q possibly damaging Het
Ambn T A 5: 88,608,617 (GRCm39) probably benign Het
Arap2 G A 5: 62,864,028 (GRCm39) T532I probably damaging Het
Arg1 T C 10: 24,796,621 (GRCm39) N69D possibly damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Asb4 A T 6: 5,390,687 (GRCm39) T27S probably benign Het
Ash1l C G 3: 88,892,602 (GRCm39) Q1494E possibly damaging Het
Car12 T C 9: 66,621,174 (GRCm39) V15A probably benign Het
Cdc20b A G 13: 113,215,232 (GRCm39) I267V probably benign Het
Cdh1 A G 8: 107,390,842 (GRCm39) I653V probably benign Het
Cenpe T A 3: 134,952,645 (GRCm39) M1445K possibly damaging Het
Cfap43 T C 19: 47,758,877 (GRCm39) E932G probably damaging Het
Cfhr1 G C 1: 139,478,642 (GRCm39) Q243E probably benign Het
Cnih2 C A 19: 5,148,276 (GRCm39) A6S possibly damaging Het
Cntnap1 G T 11: 101,079,483 (GRCm39) M1240I probably benign Het
Cntrl T C 2: 35,051,977 (GRCm39) S1050P probably benign Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dbx2 A C 15: 95,522,681 (GRCm39) L342R probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnajb2 T C 1: 75,214,121 (GRCm39) W30R probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Ednrb T A 14: 104,059,204 (GRCm39) D274V probably benign Het
Fam78b G A 1: 166,906,278 (GRCm39) V146M probably damaging Het
Fancd2 A G 6: 113,537,035 (GRCm39) probably benign Het
Fbxw14 T C 9: 109,103,692 (GRCm39) probably benign Het
Gimap4 G T 6: 48,667,905 (GRCm39) C92F probably benign Het
Gm10033 A C 8: 69,824,942 (GRCm39) noncoding transcript Het
Gm5828 A G 1: 16,840,199 (GRCm39) noncoding transcript Het
Gnpat T C 8: 125,603,680 (GRCm39) V186A probably damaging Het
Gnptab T C 10: 88,272,260 (GRCm39) S967P probably benign Het
Ikbkb T C 8: 23,157,233 (GRCm39) probably benign Het
Il1rap A T 16: 26,529,315 (GRCm39) H379L probably damaging Het
Ints12 T C 3: 132,814,921 (GRCm39) V376A probably damaging Het
Kalrn C T 16: 34,152,600 (GRCm39) S309N possibly damaging Het
Kel T A 6: 41,666,234 (GRCm39) I471L probably benign Het
Klhl25 T C 7: 75,516,480 (GRCm39) V462A probably damaging Het
Ksr1 A T 11: 78,936,019 (GRCm39) M77K probably benign Het
Leo1 T A 9: 75,353,094 (GRCm39) N212K probably damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Mast4 A G 13: 102,890,713 (GRCm39) V855A probably damaging Het
Mdga2 T A 12: 66,915,526 (GRCm39) E43V probably damaging Het
Mmaa A T 8: 79,994,588 (GRCm39) L406* probably null Het
Mtcl2 T C 2: 156,875,245 (GRCm39) E835G probably damaging Het
Nlrp12 A T 7: 3,290,079 (GRCm39) N144K probably damaging Het
Or4f61 C A 2: 111,922,675 (GRCm39) V124L probably benign Het
Or5h18 A G 16: 58,848,178 (GRCm39) F31L possibly damaging Het
Pabpc4l T C 3: 46,401,276 (GRCm39) T123A probably benign Het
Pappa2 T C 1: 158,684,836 (GRCm39) T768A probably damaging Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Ppp1r13l A G 7: 19,105,346 (GRCm39) M373V possibly damaging Het
Prss37 G A 6: 40,492,294 (GRCm39) R186* probably null Het
Psg16 C A 7: 16,824,548 (GRCm39) H111N probably benign Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Rai14 A G 15: 10,575,252 (GRCm39) F569L probably benign Het
Rbpms2 T A 9: 65,558,229 (GRCm39) D116E probably damaging Het
Rgs20 A G 1: 4,987,113 (GRCm39) probably benign Het
Rnf114 T C 2: 167,352,803 (GRCm39) L101P probably damaging Het
Rnf168 T G 16: 32,097,036 (GRCm39) L37R probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Slc2a13 A G 15: 91,400,679 (GRCm39) V181A probably damaging Het
Spag17 A G 3: 99,956,556 (GRCm39) E884G possibly damaging Het
Sycn T C 7: 28,240,713 (GRCm39) S127P probably damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tas2r117 T A 6: 132,780,129 (GRCm39) I89K probably damaging Het
Tep1 C A 14: 51,093,029 (GRCm39) probably null Het
Tex14 T C 11: 87,410,569 (GRCm39) probably benign Het
Tll1 T C 8: 64,538,591 (GRCm39) E351G probably benign Het
Tmem44 T A 16: 30,366,262 (GRCm39) K55* probably null Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Vmn1r200 C T 13: 22,579,353 (GRCm39) T43I probably damaging Het
Wars2 T C 3: 99,123,883 (GRCm39) V248A probably benign Het
Wfdc6b C T 2: 164,459,363 (GRCm39) R142C probably benign Het
Zfp729a A T 13: 67,769,613 (GRCm39) probably null Het
Zfp759 C A 13: 67,287,578 (GRCm39) probably benign Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1472:Nlrp6 UTSW 7 140,503,408 (GRCm39) missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140,502,076 (GRCm39) missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140,503,497 (GRCm39) missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140,502,725 (GRCm39) nonsense probably null
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGATCAGCCACTGGG -3'
(R):5'- AGAGGTTCCACAATGACGCC -3'

Sequencing Primer
(F):5'- TCAGCCACTGGGAACGACAG -3'
(R):5'- GACCAAGTAATTGATCACCTCTTGG -3'
Posted On 2014-09-18