Incidental Mutation 'R2118:Cdh1'
ID231204
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Namecadherin 1
SynonymsEcad, UM, uvomorulin, E-cad, L-CAM, E-cadherin
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2118 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106603351-106670246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106664210 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 653 (I653V)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
Predicted Effect probably benign
Transcript: ENSMUST00000000312
AA Change: I653V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: I653V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167688
AA Change: I653V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: I653V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 106660884 missense probably damaging 1.00
IGL01405:Cdh1 APN 8 106649001 missense probably damaging 0.97
IGL01410:Cdh1 APN 8 106657853 missense probably benign 0.19
IGL01901:Cdh1 APN 8 106657760 missense probably damaging 0.99
IGL02197:Cdh1 APN 8 106653786 missense probably benign 0.29
IGL02580:Cdh1 APN 8 106649018 missense probably benign 0.01
IGL02690:Cdh1 APN 8 106657884 missense probably damaging 1.00
IGL02732:Cdh1 APN 8 106666323 missense probably damaging 1.00
IGL02927:Cdh1 APN 8 106668511 missense probably damaging 1.00
R1777:Cdh1 UTSW 8 106656835 missense probably damaging 1.00
R1826:Cdh1 UTSW 8 106666266 missense probably benign 0.03
R1892:Cdh1 UTSW 8 106664250 missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 106666182 splice site probably benign
R2100:Cdh1 UTSW 8 106659668 missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 106653759 splice site probably benign
R2121:Cdh1 UTSW 8 106664210 missense probably benign
R2124:Cdh1 UTSW 8 106664210 missense probably benign
R2125:Cdh1 UTSW 8 106656840 missense probably damaging 0.99
R2163:Cdh1 UTSW 8 106649081 missense probably benign 0.01
R2165:Cdh1 UTSW 8 106664321 missense probably damaging 1.00
R2266:Cdh1 UTSW 8 106662003 missense probably benign
R2761:Cdh1 UTSW 8 106653849 missense possibly damaging 0.90
R4547:Cdh1 UTSW 8 106663903 missense probably damaging 1.00
R5131:Cdh1 UTSW 8 106663798 missense possibly damaging 0.95
R5767:Cdh1 UTSW 8 106668555 missense probably damaging 0.97
R5931:Cdh1 UTSW 8 106666332 critical splice donor site probably null
R6254:Cdh1 UTSW 8 106663798 missense probably damaging 1.00
R6397:Cdh1 UTSW 8 106604290 missense possibly damaging 0.81
R6888:Cdh1 UTSW 8 106658314 missense probably benign 0.09
R6928:Cdh1 UTSW 8 106661010 missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 106660913 missense probably benign 0.02
R7110:Cdh1 UTSW 8 106668544 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTGTCTTTAGAGAGGCTCTGC -3'
(R):5'- ATGGCAGGAACTTGCAATCC -3'

Sequencing Primer
(F):5'- TGATATCTGCCCCCGGTTC -3'
(R):5'- GCAATCCTGCTGCCACGATTC -3'
Posted On2014-09-18