Incidental Mutation 'R2118:Trak1'
ID231212
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R2118 (G1)
Quality Score151
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 121472997 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 940 (*940R)
Ref Sequence ENSEMBL: ENSMUSP00000044482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211301]
Predicted Effect probably null
Transcript: ENSMUST00000045903
AA Change: *940R
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: *940R

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209446
Predicted Effect probably benign
Transcript: ENSMUST00000210798
Predicted Effect probably benign
Transcript: ENSMUST00000211301
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 splice site probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7299:Trak1 UTSW 9 121451863 splice site probably null
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
R7522:Trak1 UTSW 9 121442711 missense probably damaging 0.99
R7657:Trak1 UTSW 9 121472586 missense probably damaging 1.00
R7733:Trak1 UTSW 9 121367225 missense possibly damaging 0.92
R7793:Trak1 UTSW 9 121416198 nonsense probably null
R7999:Trak1 UTSW 9 121460425 missense probably damaging 1.00
R8209:Trak1 UTSW 9 121451727 missense probably benign
R8215:Trak1 UTSW 9 121469030 missense probably damaging 1.00
R8226:Trak1 UTSW 9 121451727 missense probably benign
R8261:Trak1 UTSW 9 121451667 missense probably damaging 1.00
R8300:Trak1 UTSW 9 121460499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCCCCACCTTGACTGAGG -3'
(R):5'- AGGTCCCCAAGTCCTGTATAC -3'

Sequencing Primer
(F):5'- AACAGGGACCTCTCCTCTGTG -3'
(R):5'- GTCCTGTATACACACCATATGGAG -3'
Posted On2014-09-18