Mutagenetix > Incidental Mutations

Incidental Mutation 'R2118:Aipl1'

231218

Institutional Source

Beutler Lab

Gene Symbol

Aipl1

Ensembl Gene

ENSMUSG00000040554

Gene Name

aryl hydrocarbon receptor-interacting protein-like 1

Synonyms

MMRRC Submission

040122-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R2118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72027963-72037509 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72029369 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 291 (L291Q)

Ref Sequence

ENSEMBL: ENSMUSP00000036279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048207
AA Change: L291Q

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: L291Q

Domain	Start	End	E-Value	Type
Pfam:FKBP_C	26	154	5.2e-8	PFAM
Pfam:TPR_2	178	210	4.6e-6	PFAM
low complexity region	240	251	N/A	INTRINSIC
Pfam:TPR_2	264	296	5.5e-6	PFAM
low complexity region	302	312	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059082

SMART Domains

Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554

Domain	Start	End	E-Value	Type
Pfam:FKBP_C	25	154	1e-8	PFAM

Meta Mutation Damage Score

0.3587

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	C	11: 83,440,364	S31P	possibly damaging	Het
4933430I17Rik	T	A	4: 62,538,872	L143M	possibly damaging	Het
Abca13	T	C	11: 9,309,013		probably benign	Het
Abcg5	T	A	17: 84,671,147	E294D	probably benign	Het
Abi3bp	T	C	16: 56,477,864		probably benign	Het
Adamts8	T	C	9: 30,943,063	F76S	probably damaging	Het
Agpat3	T	C	10: 78,278,084	R257G	probably damaging	Het
Ahctf1	C	A	1: 179,769,452	R43L	probably damaging	Het
AI593442	T	C	9: 52,677,693	T195A	probably benign	Het
Ambn	T	A	5: 88,460,758		probably benign	Het
Arap2	G	A	5: 62,706,685	T532I	probably damaging	Het
Arg1	T	C	10: 24,920,723	N69D	possibly damaging	Het
Arhgef10	A	G	8: 14,934,820	D200G	probably damaging	Het
Arhgef38	T	C	3: 133,160,753	K208E	probably benign	Het
Asb4	A	T	6: 5,390,687	T27S	probably benign	Het
Ash1l	C	G	3: 88,985,295	Q1494E	possibly damaging	Het
Car12	T	C	9: 66,713,892	V15A	probably benign	Het
Cdc20b	A	G	13: 113,078,698	I267V	probably benign	Het
Cdh1	A	G	8: 106,664,210	I653V	probably benign	Het
Cenpe	T	A	3: 135,246,884	M1445K	possibly damaging	Het
Cfap43	T	C	19: 47,770,438	E932G	probably damaging	Het
Cfhr1	G	C	1: 139,550,904	Q243E	probably benign	Het
Cnih2	C	A	19: 5,098,248	A6S	possibly damaging	Het
Cntnap1	G	T	11: 101,188,657	M1240I	probably benign	Het
Cntrl	T	C	2: 35,161,965	S1050P	probably benign	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Dbx2	A	C	15: 95,624,800	L342R	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dnajb2	T	C	1: 75,237,477	W30R	probably damaging	Het
Ecel1	A	G	1: 87,148,275	S727P	probably damaging	Het
Ednrb	T	A	14: 103,821,768	D274V	probably benign	Het
Fam78b	G	A	1: 167,078,709	V146M	probably damaging	Het
Fancd2	A	G	6: 113,560,074		probably benign	Het
Fbxw14	T	C	9: 109,274,624		probably benign	Het
Gimap4	G	T	6: 48,690,971	C92F	probably benign	Het
Gm5828	A	G	1: 16,769,975		noncoding transcript	Het
Gnpat	T	C	8: 124,876,941	V186A	probably damaging	Het
Gnptab	T	C	10: 88,436,398	S967P	probably benign	Het
Ikbkb	T	C	8: 22,667,217		probably benign	Het
Il1rap	A	T	16: 26,710,565	H379L	probably damaging	Het
Ints12	T	C	3: 133,109,160	V376A	probably damaging	Het
Kalrn	C	T	16: 34,332,230	S309N	possibly damaging	Het
Kel	T	A	6: 41,689,300	I471L	probably benign	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Ksr1	A	T	11: 79,045,193	M77K	probably benign	Het
Leo1	T	A	9: 75,445,812	N212K	probably damaging	Het
Ltbp1	T	A	17: 75,310,159	V1031E	possibly damaging	Het
Ltbr	A	G	6: 125,309,477	S249P	probably benign	Het
Mast4	A	G	13: 102,754,205	V855A	probably damaging	Het
Mdga2	T	A	12: 66,868,752	E43V	probably damaging	Het
Mmaa	A	T	8: 79,267,959	L406*	probably null	Het
Nlrp12	A	T	7: 3,241,449	N144K	probably damaging	Het
Nlrp6	T	C	7: 140,926,444	V766A	probably benign	Het
Olfr1314	C	A	2: 112,092,330	V124L	probably benign	Het
Olfr186	A	G	16: 59,027,815	F31L	possibly damaging	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Pappa2	T	C	1: 158,857,266	T768A	probably damaging	Het
Pde6d	A	G	1: 86,545,802	F91L	probably benign	Het
Ppp1r13l	A	G	7: 19,371,421	M373V	possibly damaging	Het
Prss37	G	A	6: 40,515,360	R186*	probably null	Het
Psg16	C	A	7: 17,090,623	H111N	probably benign	Het
Psg20	T	A	7: 18,681,022	Y316F	probably benign	Het
Psmd1	T	A	1: 86,078,700	S263T	possibly damaging	Het
Rai14	A	G	15: 10,575,166	F569L	probably benign	Het
Rbpms2	T	A	9: 65,650,947	D116E	probably damaging	Het
Rgs20	A	G	1: 4,916,890		probably benign	Het
Rnf114	T	C	2: 167,510,883	L101P	probably damaging	Het
Rnf168	T	G	16: 32,278,218	L37R	probably damaging	Het
RP23-114B10.6	A	C	8: 69,372,290		noncoding transcript	Het
Rpe	T	C	1: 66,715,228	M153T	probably damaging	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Slc2a13	A	G	15: 91,516,476	V181A	probably damaging	Het
Soga1	T	C	2: 157,033,325	E835G	probably damaging	Het
Spag17	A	G	3: 100,049,240	E884G	possibly damaging	Het
Sycn	T	C	7: 28,541,288	S127P	probably damaging	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tas2r117	T	A	6: 132,803,166	I89K	probably damaging	Het
Tep1	C	A	14: 50,855,572		probably null	Het
Tex14	T	C	11: 87,519,743		probably benign	Het
Tll1	T	C	8: 64,085,557	E351G	probably benign	Het
Tmem44	T	A	16: 30,547,444	K55*	probably null	Het
Trak1	T	A	9: 121,472,997	*940R	probably null	Het
Vmn1r200	C	T	13: 22,395,183	T43I	probably damaging	Het
Wars2	T	C	3: 99,216,567	V248A	probably benign	Het
Wfdc6b	C	T	2: 164,617,443	R142C	probably benign	Het
Zfp729a	A	T	13: 67,621,494		probably null	Het
Zfp759	C	A	13: 67,139,514		probably benign	Het

Other mutations in Aipl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Aipl1	APN	11	72031547	missense	probably damaging	1.00
IGL01713:Aipl1	APN	11	72036623	missense	probably damaging	1.00
IGL02031:Aipl1	APN	11	72030202	utr 3 prime	probably benign
IGL02603:Aipl1	APN	11	72036700	missense	possibly damaging	0.82
IGL02677:Aipl1	APN	11	72029396	missense	possibly damaging	0.90
R1563:Aipl1	UTSW	11	72036712	missense	probably damaging	0.99
R1835:Aipl1	UTSW	11	72030499	missense	possibly damaging	0.91
R2041:Aipl1	UTSW	11	72031506	missense	possibly damaging	0.87
R2216:Aipl1	UTSW	11	72031446	missense	probably damaging	1.00
R4001:Aipl1	UTSW	11	72031602	missense	probably damaging	1.00
R4969:Aipl1	UTSW	11	72031430	missense	probably benign	0.22
R5428:Aipl1	UTSW	11	72030487	missense	probably benign	0.02
R5933:Aipl1	UTSW	11	72030282	missense	probably benign	0.01
R8151:Aipl1	UTSW	11	72036758	missense	probably benign	0.44
R8379:Aipl1	UTSW	11	72029300	missense	probably benign	0.05
R8406:Aipl1	UTSW	11	72031506	missense	possibly damaging	0.87
X0018:Aipl1	UTSW	11	72030541	missense	probably benign	0.00
Z1176:Aipl1	UTSW	11	72030533	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CTGGTAGCCAAGAACACCTC -3'
(R):5'- TGGTCACAGGATTTGGGAAG -3'

Sequencing Primer
(F):5'- TACCCTGCAGCAAGAGGAGC -3'
(R):5'- TCACAGGATTTGGGAAGAAACG -3'

Posted On

2014-09-18