Mutagenetix > Incidental Mutations

Incidental Mutation 'R2118:Mdga2'

231223

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

MMRRC Submission

040122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66868752 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 43 (E43V)

Ref Sequence

ENSEMBL: ENSMUSP00000152613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037181
AA Change: E112V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: E112V

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000101379
AA Change: E96V

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912
AA Change: E96V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000178814
AA Change: E102V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: E102V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000222167
AA Change: E43V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223141
AA Change: E43V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.4599

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (90/90)

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	C	11: 83,440,364	S31P	possibly damaging	Het
4933430I17Rik	T	A	4: 62,538,872	L143M	possibly damaging	Het
Abca13	T	C	11: 9,309,013		probably benign	Het
Abcg5	T	A	17: 84,671,147	E294D	probably benign	Het
Abi3bp	T	C	16: 56,477,864		probably benign	Het
Adamts8	T	C	9: 30,943,063	F76S	probably damaging	Het
Agpat3	T	C	10: 78,278,084	R257G	probably damaging	Het
Ahctf1	C	A	1: 179,769,452	R43L	probably damaging	Het
AI593442	T	C	9: 52,677,693	T195A	probably benign	Het
Aipl1	A	T	11: 72,029,369	L291Q	possibly damaging	Het
Ambn	T	A	5: 88,460,758		probably benign	Het
Arap2	G	A	5: 62,706,685	T532I	probably damaging	Het
Arg1	T	C	10: 24,920,723	N69D	possibly damaging	Het
Arhgef10	A	G	8: 14,934,820	D200G	probably damaging	Het
Arhgef38	T	C	3: 133,160,753	K208E	probably benign	Het
Asb4	A	T	6: 5,390,687	T27S	probably benign	Het
Ash1l	C	G	3: 88,985,295	Q1494E	possibly damaging	Het
Car12	T	C	9: 66,713,892	V15A	probably benign	Het
Cdc20b	A	G	13: 113,078,698	I267V	probably benign	Het
Cdh1	A	G	8: 106,664,210	I653V	probably benign	Het
Cenpe	T	A	3: 135,246,884	M1445K	possibly damaging	Het
Cfap43	T	C	19: 47,770,438	E932G	probably damaging	Het
Cfhr1	G	C	1: 139,550,904	Q243E	probably benign	Het
Cnih2	C	A	19: 5,098,248	A6S	possibly damaging	Het
Cntnap1	G	T	11: 101,188,657	M1240I	probably benign	Het
Cntrl	T	C	2: 35,161,965	S1050P	probably benign	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Dbx2	A	C	15: 95,624,800	L342R	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dnajb2	T	C	1: 75,237,477	W30R	probably damaging	Het
Ecel1	A	G	1: 87,148,275	S727P	probably damaging	Het
Ednrb	T	A	14: 103,821,768	D274V	probably benign	Het
Fam78b	G	A	1: 167,078,709	V146M	probably damaging	Het
Fancd2	A	G	6: 113,560,074		probably benign	Het
Fbxw14	T	C	9: 109,274,624		probably benign	Het
Gimap4	G	T	6: 48,690,971	C92F	probably benign	Het
Gm5828	A	G	1: 16,769,975		noncoding transcript	Het
Gnpat	T	C	8: 124,876,941	V186A	probably damaging	Het
Gnptab	T	C	10: 88,436,398	S967P	probably benign	Het
Ikbkb	T	C	8: 22,667,217		probably benign	Het
Il1rap	A	T	16: 26,710,565	H379L	probably damaging	Het
Ints12	T	C	3: 133,109,160	V376A	probably damaging	Het
Kalrn	C	T	16: 34,332,230	S309N	possibly damaging	Het
Kel	T	A	6: 41,689,300	I471L	probably benign	Het
Klhl25	T	C	7: 75,866,732	V462A	probably damaging	Het
Ksr1	A	T	11: 79,045,193	M77K	probably benign	Het
Leo1	T	A	9: 75,445,812	N212K	probably damaging	Het
Ltbp1	T	A	17: 75,310,159	V1031E	possibly damaging	Het
Ltbr	A	G	6: 125,309,477	S249P	probably benign	Het
Mast4	A	G	13: 102,754,205	V855A	probably damaging	Het
Mmaa	A	T	8: 79,267,959	L406*	probably null	Het
Nlrp12	A	T	7: 3,241,449	N144K	probably damaging	Het
Nlrp6	T	C	7: 140,926,444	V766A	probably benign	Het
Olfr1314	C	A	2: 112,092,330	V124L	probably benign	Het
Olfr186	A	G	16: 59,027,815	F31L	possibly damaging	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Pappa2	T	C	1: 158,857,266	T768A	probably damaging	Het
Pde6d	A	G	1: 86,545,802	F91L	probably benign	Het
Ppp1r13l	A	G	7: 19,371,421	M373V	possibly damaging	Het
Prss37	G	A	6: 40,515,360	R186*	probably null	Het
Psg16	C	A	7: 17,090,623	H111N	probably benign	Het
Psg20	T	A	7: 18,681,022	Y316F	probably benign	Het
Psmd1	T	A	1: 86,078,700	S263T	possibly damaging	Het
Rai14	A	G	15: 10,575,166	F569L	probably benign	Het
Rbpms2	T	A	9: 65,650,947	D116E	probably damaging	Het
Rgs20	A	G	1: 4,916,890		probably benign	Het
Rnf114	T	C	2: 167,510,883	L101P	probably damaging	Het
Rnf168	T	G	16: 32,278,218	L37R	probably damaging	Het
RP23-114B10.6	A	C	8: 69,372,290		noncoding transcript	Het
Rpe	T	C	1: 66,715,228	M153T	probably damaging	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Slc2a13	A	G	15: 91,516,476	V181A	probably damaging	Het
Soga1	T	C	2: 157,033,325	E835G	probably damaging	Het
Spag17	A	G	3: 100,049,240	E884G	possibly damaging	Het
Sycn	T	C	7: 28,541,288	S127P	probably damaging	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tas2r117	T	A	6: 132,803,166	I89K	probably damaging	Het
Tep1	C	A	14: 50,855,572		probably null	Het
Tex14	T	C	11: 87,519,743		probably benign	Het
Tll1	T	C	8: 64,085,557	E351G	probably benign	Het
Tmem44	T	A	16: 30,547,444	K55*	probably null	Het
Trak1	T	A	9: 121,472,997	*940R	probably null	Het
Vmn1r200	C	T	13: 22,395,183	T43I	probably damaging	Het
Wars2	T	C	3: 99,216,567	V248A	probably benign	Het
Wfdc6b	C	T	2: 164,617,443	R142C	probably benign	Het
Zfp729a	A	T	13: 67,621,494		probably null	Het
Zfp759	C	A	13: 67,139,514		probably benign	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
R8319:Mdga2	UTSW	12	67221029	missense	unknown
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCTTTCTCGGAAGTGTATTCTC -3'
(R):5'- GGCAAGTACAAAGTGTTGGGTC -3'

Sequencing Primer
(F):5'- CGGAAGTGTATTCTCAATTTCTCAC -3'
(R):5'- AAGTACAAAGTGTTGGGTCTGCTATG -3'

Posted On

2014-09-18