Incidental Mutation 'R2118:Sap18'
ID231229
Institutional Source Beutler Lab
Gene Symbol Sap18
Ensembl Gene ENSMUSG00000021963
Gene NameSin3-associated polypeptide 18
SynonymsEMegR4, C530046K05Rik, SAP18, Sinbp1, D11Ertd539e, EMegR4
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2118 (G1)
Quality Score123
Status Validated
Chromosome14
Chromosomal Location57798180-57806638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57798554 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 66 (S66T)
Ref Sequence ENSEMBL: ENSMUSP00000106900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111267] [ENSMUST00000111268] [ENSMUST00000111269] [ENSMUST00000128764] [ENSMUST00000143600]
Predicted Effect probably benign
Transcript: ENSMUST00000111267
SMART Domains Protein: ENSMUSP00000106898
Gene: ENSMUSG00000021963

DomainStartEndE-ValueType
Pfam:SAP18 1 76 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111268
SMART Domains Protein: ENSMUSP00000106899
Gene: ENSMUSG00000021963

DomainStartEndE-ValueType
Pfam:SAP18 1 76 3.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111269
AA Change: S66T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106900
Gene: ENSMUSG00000021963
AA Change: S66T

DomainStartEndE-ValueType
Pfam:SAP18 35 104 4.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128764
AA Change: S66T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120071
Gene: ENSMUSG00000021963
AA Change: S66T

DomainStartEndE-ValueType
Pfam:SAP18 38 156 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131455
Predicted Effect probably benign
Transcript: ENSMUST00000143600
AA Change: S5T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121525
Gene: ENSMUSG00000021963
AA Change: S5T

DomainStartEndE-ValueType
Pfam:SAP18 1 95 2.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175043
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Sap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2018:Sap18 UTSW 14 57798564 missense probably damaging 1.00
R2119:Sap18 UTSW 14 57798554 missense probably damaging 0.99
R2121:Sap18 UTSW 14 57798554 missense probably damaging 0.99
R2122:Sap18 UTSW 14 57798554 missense probably damaging 0.99
R2124:Sap18 UTSW 14 57798554 missense probably damaging 0.99
R3153:Sap18 UTSW 14 57801945 missense probably benign
R4827:Sap18 UTSW 14 57798563 missense probably damaging 1.00
R5408:Sap18 UTSW 14 57801974 missense probably benign
R6287:Sap18 UTSW 14 57798314 missense probably damaging 1.00
R6755:Sap18 UTSW 14 57802017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGTTACCCAGGAGGAAATTAAG -3'
(R):5'- TATCCTTTTGTACCGGGCGG -3'

Sequencing Primer
(F):5'- TCGACCGCGAGAAGGTG -3'
(R):5'- GTTCACTCTGACCTAACG -3'
Posted On2014-09-18