Incidental Mutation 'R2118:Ednrb'
ID 231230
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 040122-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R2118 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104059204 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 274 (D274V)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably benign
Transcript: ENSMUST00000022718
AA Change: D274V

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: D274V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172237
AA Change: D274V

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: D274V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227824
AA Change: D274V

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1655 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,331,190 (GRCm39) S31P possibly damaging Het
4933430I17Rik T A 4: 62,457,109 (GRCm39) L143M possibly damaging Het
Abca13 T C 11: 9,259,013 (GRCm39) probably benign Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Abi3bp T C 16: 56,298,227 (GRCm39) probably benign Het
Adamts8 T C 9: 30,854,359 (GRCm39) F76S probably damaging Het
Agpat3 T C 10: 78,113,918 (GRCm39) R257G probably damaging Het
Ahctf1 C A 1: 179,597,017 (GRCm39) R43L probably damaging Het
AI593442 T C 9: 52,588,993 (GRCm39) T195A probably benign Het
Aipl1 A T 11: 71,920,195 (GRCm39) L291Q possibly damaging Het
Ambn T A 5: 88,608,617 (GRCm39) probably benign Het
Arap2 G A 5: 62,864,028 (GRCm39) T532I probably damaging Het
Arg1 T C 10: 24,796,621 (GRCm39) N69D possibly damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Asb4 A T 6: 5,390,687 (GRCm39) T27S probably benign Het
Ash1l C G 3: 88,892,602 (GRCm39) Q1494E possibly damaging Het
Car12 T C 9: 66,621,174 (GRCm39) V15A probably benign Het
Cdc20b A G 13: 113,215,232 (GRCm39) I267V probably benign Het
Cdh1 A G 8: 107,390,842 (GRCm39) I653V probably benign Het
Cenpe T A 3: 134,952,645 (GRCm39) M1445K possibly damaging Het
Cfap43 T C 19: 47,758,877 (GRCm39) E932G probably damaging Het
Cfhr1 G C 1: 139,478,642 (GRCm39) Q243E probably benign Het
Cnih2 C A 19: 5,148,276 (GRCm39) A6S possibly damaging Het
Cntnap1 G T 11: 101,079,483 (GRCm39) M1240I probably benign Het
Cntrl T C 2: 35,051,977 (GRCm39) S1050P probably benign Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dbx2 A C 15: 95,522,681 (GRCm39) L342R probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnajb2 T C 1: 75,214,121 (GRCm39) W30R probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Fam78b G A 1: 166,906,278 (GRCm39) V146M probably damaging Het
Fancd2 A G 6: 113,537,035 (GRCm39) probably benign Het
Fbxw14 T C 9: 109,103,692 (GRCm39) probably benign Het
Gimap4 G T 6: 48,667,905 (GRCm39) C92F probably benign Het
Gm10033 A C 8: 69,824,942 (GRCm39) noncoding transcript Het
Gm5828 A G 1: 16,840,199 (GRCm39) noncoding transcript Het
Gnpat T C 8: 125,603,680 (GRCm39) V186A probably damaging Het
Gnptab T C 10: 88,272,260 (GRCm39) S967P probably benign Het
Ikbkb T C 8: 23,157,233 (GRCm39) probably benign Het
Il1rap A T 16: 26,529,315 (GRCm39) H379L probably damaging Het
Ints12 T C 3: 132,814,921 (GRCm39) V376A probably damaging Het
Kalrn C T 16: 34,152,600 (GRCm39) S309N possibly damaging Het
Kel T A 6: 41,666,234 (GRCm39) I471L probably benign Het
Klhl25 T C 7: 75,516,480 (GRCm39) V462A probably damaging Het
Ksr1 A T 11: 78,936,019 (GRCm39) M77K probably benign Het
Leo1 T A 9: 75,353,094 (GRCm39) N212K probably damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Mast4 A G 13: 102,890,713 (GRCm39) V855A probably damaging Het
Mdga2 T A 12: 66,915,526 (GRCm39) E43V probably damaging Het
Mmaa A T 8: 79,994,588 (GRCm39) L406* probably null Het
Mtcl2 T C 2: 156,875,245 (GRCm39) E835G probably damaging Het
Nlrp12 A T 7: 3,290,079 (GRCm39) N144K probably damaging Het
Nlrp6 T C 7: 140,506,357 (GRCm39) V766A probably benign Het
Or4f61 C A 2: 111,922,675 (GRCm39) V124L probably benign Het
Or5h18 A G 16: 58,848,178 (GRCm39) F31L possibly damaging Het
Pabpc4l T C 3: 46,401,276 (GRCm39) T123A probably benign Het
Pappa2 T C 1: 158,684,836 (GRCm39) T768A probably damaging Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Ppp1r13l A G 7: 19,105,346 (GRCm39) M373V possibly damaging Het
Prss37 G A 6: 40,492,294 (GRCm39) R186* probably null Het
Psg16 C A 7: 16,824,548 (GRCm39) H111N probably benign Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Rai14 A G 15: 10,575,252 (GRCm39) F569L probably benign Het
Rbpms2 T A 9: 65,558,229 (GRCm39) D116E probably damaging Het
Rgs20 A G 1: 4,987,113 (GRCm39) probably benign Het
Rnf114 T C 2: 167,352,803 (GRCm39) L101P probably damaging Het
Rnf168 T G 16: 32,097,036 (GRCm39) L37R probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Slc2a13 A G 15: 91,400,679 (GRCm39) V181A probably damaging Het
Spag17 A G 3: 99,956,556 (GRCm39) E884G possibly damaging Het
Sycn T C 7: 28,240,713 (GRCm39) S127P probably damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tas2r117 T A 6: 132,780,129 (GRCm39) I89K probably damaging Het
Tep1 C A 14: 51,093,029 (GRCm39) probably null Het
Tex14 T C 11: 87,410,569 (GRCm39) probably benign Het
Tll1 T C 8: 64,538,591 (GRCm39) E351G probably benign Het
Tmem44 T A 16: 30,366,262 (GRCm39) K55* probably null Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Vmn1r200 C T 13: 22,579,353 (GRCm39) T43I probably damaging Het
Wars2 T C 3: 99,123,883 (GRCm39) V248A probably benign Het
Wfdc6b C T 2: 164,459,363 (GRCm39) R142C probably benign Het
Zfp729a A T 13: 67,769,613 (GRCm39) probably null Het
Zfp759 C A 13: 67,287,578 (GRCm39) probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATCATCATGACTTAGATCTGACC -3'
(R):5'- AAGAATTTTGCTCAGCTCCCTACAG -3'

Sequencing Primer
(F):5'- CAATCTGCATACCGCTCTT -3'
(R):5'- GTTCAGTAGATATGGCCCACG -3'
Posted On 2014-09-18