Mutagenetix > Incidental Mutation

Incidental Mutation 'R2119:Cdh19'

231253

Institutional Source

Beutler Lab

Gene Symbol

Cdh19

Ensembl Gene

ENSMUSG00000047216

Gene Name

cadherin 19, type 2

Synonyms

MMRRC Submission

040123-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2119 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110888326-110977584 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110919590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 430 (V430I)

Ref Sequence

ENSEMBL: ENSMUSP00000092210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094626]

AlphaFold

E9Q3A7

Predicted Effect

probably benign
Transcript: ENSMUST00000094626
AA Change: V430I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216
AA Change: V430I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
CA	64	144	2.44e-14	SMART
CA	168	252	3.21e-23	SMART
CA	276	367	6.2e-7	SMART
CA	390	466	2.69e-16	SMART
CA	489	576	6.68e-3	SMART
transmembrane domain	594	616	N/A	INTRINSIC
Pfam:Cadherin_C	619	764	1.7e-50	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	T	A	4: 62,538,872	L143M	possibly damaging	Het
Actbl2	G	A	13: 111,255,160	V10I	probably benign	Het
Adamts12	C	T	15: 11,310,579	T974I	probably damaging	Het
Aifm2	G	A	10: 61,735,604	V306M	possibly damaging	Het
Arhgef38	T	C	3: 133,160,753	K208E	probably benign	Het
Atxn7l3	C	A	11: 102,291,981	R278L	possibly damaging	Het
Bcl9	A	G	3: 97,208,915	L821P	probably benign	Het
Clns1a	T	A	7: 97,713,904		probably null	Het
Col3a1	T	A	1: 45,346,121	C133S	probably damaging	Het
Csmd1	G	A	8: 17,216,733	T59I	probably damaging	Het
Cyp2a12	A	G	7: 27,036,646	*493W	probably null	Het
Cyp2j8	A	T	4: 96,507,201	D62E	probably benign	Het
Dcbld1	A	T	10: 52,319,979	M428L	probably benign	Het
Dhx32	A	T	7: 133,722,247	Y523*	probably null	Het
Dlgap2	C	T	8: 14,778,206	A538V	possibly damaging	Het
Dlgap3	T	C	4: 127,236,189	S919P	probably benign	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsc1	A	T	18: 20,110,152	H81Q	probably benign	Het
Dusp8	A	T	7: 142,082,561	S431T	possibly damaging	Het
Dync1i1	A	T	6: 5,767,096	T59S	probably damaging	Het
Ecel1	A	G	1: 87,148,275	S727P	probably damaging	Het
Ednrb	T	A	14: 103,821,768	D274V	probably benign	Het
Eef1d	G	T	15: 75,903,213	A199E	probably benign	Het
Eml3	T	A	19: 8,934,354		probably null	Het
Enah	G	T	1: 181,921,753	A138E	probably damaging	Het
Fgf18	A	C	11: 33,118,003	F129C	probably damaging	Het
Gba	A	T	3: 89,205,561	E170V	probably benign	Het
Hdac1	C	T	4: 129,522,364	R212Q	probably benign	Het
Heatr1	T	A	13: 12,432,646	L1740Q	probably null	Het
Inhbb	T	A	1: 119,420,701	H129L	probably benign	Het
Inpp5b	T	A	4: 124,797,869	H862Q	probably benign	Het
Itsn2	C	A	12: 4,707,025	R1372S	probably benign	Het
Jaml	T	A	9: 45,101,064	I283N	probably damaging	Het
Klk1b21	A	T	7: 44,105,769	T163S	probably benign	Het
Lmo3	A	T	6: 138,416,494	C43S	probably damaging	Het
Metrn	C	T	17: 25,795,223	V210I	probably benign	Het
Ndufaf7	A	T	17: 78,945,013	I284F	possibly damaging	Het
Nlrp6	T	C	7: 140,926,444	V766A	probably benign	Het
Olfr713	A	G	7: 107,036,731	D192G	probably damaging	Het
Osbpl7	T	C	11: 97,056,079	S403P	probably benign	Het
Pabpc4l	T	C	3: 46,446,841	T123A	probably benign	Het
Pde6d	A	G	1: 86,545,802	F91L	probably benign	Het
Psg20	T	A	7: 18,681,022	Y316F	probably benign	Het
Psmd1	T	A	1: 86,078,700	S263T	possibly damaging	Het
Pum1	C	A	4: 130,669,270	T112K	possibly damaging	Het
Rasgrp2	T	A	19: 6,404,395	M156K	probably benign	Het
Reln	T	A	5: 22,019,000	E917V	probably damaging	Het
Rfc4	A	T	16: 23,124,564	V61E	probably damaging	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rpe	T	C	1: 66,715,228	M153T	probably damaging	Het
Rtn4ip1	A	G	10: 43,935,997		probably null	Het
Sap18	T	A	14: 57,798,554	S66T	probably damaging	Het
Scamp5	C	A	9: 57,447,225	V49F	possibly damaging	Het
Serhl	A	G	15: 83,115,575	Q252R	probably benign	Het
Sestd1	T	C	2: 77,212,523	D229G	probably benign	Het
Slc35g1	T	C	19: 38,403,287	V339A	probably benign	Het
Slc9b2	T	A	3: 135,328,982		probably null	Het
Stk40	C	T	4: 126,128,847	T138I	probably benign	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Tep1	T	G	14: 50,838,986	K1664Q	probably benign	Het
Tmod2	T	C	9: 75,586,095	K193E	possibly damaging	Het
Trak1	T	A	9: 121,472,997	*940R	probably null	Het
Ttc5	A	T	14: 50,775,365	Y189N	probably damaging	Het
Ugt2a3	A	T	5: 87,336,571	M198K	probably damaging	Het
Uox	A	G	3: 146,612,542	H66R	probably benign	Het
Usp9y	A	T	Y: 1,303,451	D2487E	probably benign	Het
Vnn3	G	A	10: 23,864,413	G205R	probably damaging	Het
Vps11	T	C	9: 44,348,997	D856G	probably benign	Het
Zdhhc17	T	C	10: 110,982,048	N90D	possibly damaging	Het
Zfp105	T	A	9: 122,929,678	L138*	probably null	Het
Zfp28	A	G	7: 6,394,876	Y770C	probably benign	Het
Zfp655	T	A	5: 145,244,784	L484Q	probably damaging	Het
Zfp868	C	A	8: 69,611,995	E230*	probably null	Het
Zfpm2	A	G	15: 41,103,023	Y836C	probably damaging	Het

Other mutations in Cdh19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Cdh19	APN	1	110949252	missense	probably damaging	1.00
IGL00863:Cdh19	APN	1	110949144	missense	probably damaging	1.00
IGL01537:Cdh19	APN	1	110919611	missense	possibly damaging	0.73
IGL02108:Cdh19	APN	1	110889731	missense	probably benign	0.31
IGL02125:Cdh19	APN	1	110929884	missense	possibly damaging	0.94
IGL02234:Cdh19	APN	1	110932226	missense	probably damaging	1.00
IGL02251:Cdh19	APN	1	110954652	missense	probably benign	0.00
IGL02275:Cdh19	APN	1	110925886	missense	probably benign	0.21
IGL03203:Cdh19	APN	1	110890098	missense	possibly damaging	0.82
R0539:Cdh19	UTSW	1	110925162	missense	possibly damaging	0.81
R0594:Cdh19	UTSW	1	110925867	missense	probably benign	0.40
R0612:Cdh19	UTSW	1	110893170	splice site	probably benign
R1028:Cdh19	UTSW	1	110954584	missense	probably benign	0.03
R1627:Cdh19	UTSW	1	110919645	missense	probably benign	0.16
R1728:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1729:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1730:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1739:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1762:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1783:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1785:Cdh19	UTSW	1	110893384	missense	probably damaging	0.98
R1974:Cdh19	UTSW	1	110890159	missense	possibly damaging	0.50
R3026:Cdh19	UTSW	1	110954688	missense	probably benign	0.03
R3037:Cdh19	UTSW	1	110954607	missense	probably damaging	1.00
R3612:Cdh19	UTSW	1	110893296	missense	probably damaging	1.00
R4254:Cdh19	UTSW	1	110925030	missense	probably damaging	1.00
R4368:Cdh19	UTSW	1	110889712	nonsense	probably null
R4624:Cdh19	UTSW	1	110932251	missense	probably benign	0.25
R4648:Cdh19	UTSW	1	110925177	missense	probably benign	0.04
R4720:Cdh19	UTSW	1	110895381	critical splice donor site	probably null
R4766:Cdh19	UTSW	1	110893260	missense	probably benign	0.39
R4937:Cdh19	UTSW	1	110889964	missense	probably damaging	1.00
R4968:Cdh19	UTSW	1	110925228	missense	probably benign	0.08
R4970:Cdh19	UTSW	1	110954624	missense	possibly damaging	0.68
R5095:Cdh19	UTSW	1	110954661	missense	probably benign
R5112:Cdh19	UTSW	1	110954624	missense	possibly damaging	0.68
R5586:Cdh19	UTSW	1	110929857	missense	probably damaging	1.00
R6431:Cdh19	UTSW	1	110925057	missense	probably benign	0.00
R6595:Cdh19	UTSW	1	110925787	missense	probably benign	0.15
R6997:Cdh19	UTSW	1	110954866	start gained	probably benign
R7240:Cdh19	UTSW	1	110893407	missense	probably benign
R8252:Cdh19	UTSW	1	110889885	missense	probably benign	0.00
R8299:Cdh19	UTSW	1	110919548	missense	probably benign	0.01
R8416:Cdh19	UTSW	1	110925880	missense	probably benign	0.13
R8766:Cdh19	UTSW	1	110890114	missense	probably benign	0.33
R9090:Cdh19	UTSW	1	110949217	missense	probably damaging	1.00
R9177:Cdh19	UTSW	1	110949381	missense	probably damaging	1.00
R9266:Cdh19	UTSW	1	110890041	missense	probably damaging	1.00
R9268:Cdh19	UTSW	1	110949381	missense	probably damaging	1.00
R9271:Cdh19	UTSW	1	110949217	missense	probably damaging	1.00
R9533:Cdh19	UTSW	1	110889859	missense	probably damaging	1.00
R9560:Cdh19	UTSW	1	110893274	missense	possibly damaging	0.61
R9765:Cdh19	UTSW	1	110895381	critical splice donor site	probably null
Z1176:Cdh19	UTSW	1	110893306	missense	probably benign	0.00
Z1176:Cdh19	UTSW	1	110895387	missense	probably damaging	1.00
Z1176:Cdh19	UTSW	1	110932214	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCAGTTACCACAGCATTCC -3'
(R):5'- ATTTCTCCTGCAGCTTTGAATG -3'

Sequencing Primer
(F):5'- CATTATACTGTGTGTTTCATTCAACC -3'
(R):5'- GTGGGTATATCCTACAACATTGC -3'

Posted On

2014-09-18