Incidental Mutation 'R2119:Dlgap3'
ID231274
Institutional Source Beutler Lab
Gene Symbol Dlgap3
Ensembl Gene ENSMUSG00000042388
Gene NameDLG associated protein 3
SynonymsPSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2119 (G1)
Quality Score111
Status Not validated
Chromosome4
Chromosomal Location127169204-127237022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127236189 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 919 (S919P)
Ref Sequence ENSEMBL: ENSMUSP00000101700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046659] [ENSMUST00000106092] [ENSMUST00000106094]
Predicted Effect probably benign
Transcript: ENSMUST00000046659
AA Change: S919P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039724
Gene: ENSMUSG00000042388
AA Change: S919P

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 977 1.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106092
AA Change: S908P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: S908P

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106094
AA Change: S919P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101700
Gene: ENSMUSG00000042388
AA Change: S919P

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 626 977 1.3e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit skin lesions associated with excessive grooming, increased anxiety-related behaviors, altered synaptic transmission and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Dlgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Dlgap3 APN 4 127233897 missense probably benign 0.01
IGL03122:Dlgap3 APN 4 127195225 missense possibly damaging 0.86
IGL03259:Dlgap3 APN 4 127200284 missense probably benign 0.05
Compulsive UTSW 4 127195709 nonsense probably null
R0363:Dlgap3 UTSW 4 127235521 missense probably damaging 1.00
R1222:Dlgap3 UTSW 4 127194613 start codon destroyed probably null 0.01
R1386:Dlgap3 UTSW 4 127194926 missense possibly damaging 0.81
R1603:Dlgap3 UTSW 4 127195228 missense probably damaging 1.00
R2073:Dlgap3 UTSW 4 127195366 missense probably damaging 0.99
R2696:Dlgap3 UTSW 4 127194623 missense probably damaging 1.00
R3076:Dlgap3 UTSW 4 127195706 missense probably damaging 1.00
R3738:Dlgap3 UTSW 4 127195606 missense probably damaging 0.99
R4344:Dlgap3 UTSW 4 127214348 missense possibly damaging 0.84
R4676:Dlgap3 UTSW 4 127233761 missense probably damaging 0.99
R4720:Dlgap3 UTSW 4 127195715 critical splice donor site probably null
R4893:Dlgap3 UTSW 4 127194983 missense probably damaging 1.00
R5384:Dlgap3 UTSW 4 127236330 missense probably damaging 1.00
R5841:Dlgap3 UTSW 4 127195400 missense probably damaging 1.00
R5870:Dlgap3 UTSW 4 127195709 nonsense probably null
R6379:Dlgap3 UTSW 4 127234974 missense probably damaging 1.00
R7028:Dlgap3 UTSW 4 127195517 missense possibly damaging 0.74
R7454:Dlgap3 UTSW 4 127235059 missense probably null 0.01
R7479:Dlgap3 UTSW 4 127194625 missense possibly damaging 0.72
R8104:Dlgap3 UTSW 4 127236154 missense probably damaging 0.99
X0024:Dlgap3 UTSW 4 127236172 missense probably damaging 1.00
Z1177:Dlgap3 UTSW 4 127194984 missense probably damaging 0.99
Z1177:Dlgap3 UTSW 4 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATTCTAGACGCTGTCC -3'
(R):5'- CTTTGCGTGGGATCAGGAAG -3'

Sequencing Primer
(F):5'- AATTCTAGACGCTGTCCCATTGGG -3'
(R):5'- TCGACGCTGGGTGTACAGTAC -3'
Posted On2014-09-18