Incidental Mutation 'R2119:Ugt2a3'
ID 231278
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene Name UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms 2010321J07Rik
MMRRC Submission 040123-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2119 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87472831-87485054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87484430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
AlphaFold Q8BWQ1
Predicted Effect probably damaging
Transcript: ENSMUST00000031195
AA Change: M198K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: M198K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,457,109 (GRCm39) L143M possibly damaging Het
Actbl2 G A 13: 111,391,694 (GRCm39) V10I probably benign Het
Adamts12 C T 15: 11,310,665 (GRCm39) T974I probably damaging Het
Aifm2 G A 10: 61,571,383 (GRCm39) V306M possibly damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Atxn7l3 C A 11: 102,182,807 (GRCm39) R278L possibly damaging Het
Bcl9 A G 3: 97,116,231 (GRCm39) L821P probably benign Het
Cdh19 C T 1: 110,847,320 (GRCm39) V430I probably benign Het
Clns1a T A 7: 97,363,111 (GRCm39) probably null Het
Col3a1 T A 1: 45,385,281 (GRCm39) C133S probably damaging Het
Csmd1 G A 8: 17,266,749 (GRCm39) T59I probably damaging Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Cyp2j8 A T 4: 96,395,438 (GRCm39) D62E probably benign Het
Dcbld1 A T 10: 52,196,075 (GRCm39) M428L probably benign Het
Dhx32 A T 7: 133,323,976 (GRCm39) Y523* probably null Het
Dlgap2 C T 8: 14,828,206 (GRCm39) A538V possibly damaging Het
Dlgap3 T C 4: 127,129,982 (GRCm39) S919P probably benign Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dsc1 A T 18: 20,243,209 (GRCm39) H81Q probably benign Het
Dusp8 A T 7: 141,636,298 (GRCm39) S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 (GRCm39) T59S probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Ednrb T A 14: 104,059,204 (GRCm39) D274V probably benign Het
Eef1d G T 15: 75,775,062 (GRCm39) A199E probably benign Het
Eml3 T A 19: 8,911,718 (GRCm39) probably null Het
Enah G T 1: 181,749,318 (GRCm39) A138E probably damaging Het
Fgf18 A C 11: 33,068,003 (GRCm39) F129C probably damaging Het
Gba1 A T 3: 89,112,868 (GRCm39) E170V probably benign Het
Hdac1 C T 4: 129,416,157 (GRCm39) R212Q probably benign Het
Heatr1 T A 13: 12,447,527 (GRCm39) L1740Q probably null Het
Inhbb T A 1: 119,348,431 (GRCm39) H129L probably benign Het
Inpp5b T A 4: 124,691,662 (GRCm39) H862Q probably benign Het
Itsn2 C A 12: 4,757,025 (GRCm39) R1372S probably benign Het
Jaml T A 9: 45,012,362 (GRCm39) I283N probably damaging Het
Klk1b21 A T 7: 43,755,193 (GRCm39) T163S probably benign Het
Lmo3 A T 6: 138,393,492 (GRCm39) C43S probably damaging Het
Metrn C T 17: 26,014,197 (GRCm39) V210I probably benign Het
Ndufaf7 A T 17: 79,252,442 (GRCm39) I284F possibly damaging Het
Nlrp6 T C 7: 140,506,357 (GRCm39) V766A probably benign Het
Or10a5 A G 7: 106,635,938 (GRCm39) D192G probably damaging Het
Osbpl7 T C 11: 96,946,905 (GRCm39) S403P probably benign Het
Pabpc4l T C 3: 46,401,276 (GRCm39) T123A probably benign Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Pum1 C A 4: 130,396,581 (GRCm39) T112K possibly damaging Het
Rasgrp2 T A 19: 6,454,425 (GRCm39) M156K probably benign Het
Reln T A 5: 22,223,998 (GRCm39) E917V probably damaging Het
Rfc4 A T 16: 22,943,314 (GRCm39) V61E probably damaging Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Rtn4ip1 A G 10: 43,811,993 (GRCm39) probably null Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Scamp5 C A 9: 57,354,508 (GRCm39) V49F possibly damaging Het
Serhl A G 15: 82,999,776 (GRCm39) Q252R probably benign Het
Sestd1 T C 2: 77,042,867 (GRCm39) D229G probably benign Het
Slc35g1 T C 19: 38,391,735 (GRCm39) V339A probably benign Het
Slc9b2 T A 3: 135,034,743 (GRCm39) probably null Het
Stk40 C T 4: 126,022,640 (GRCm39) T138I probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Tep1 T G 14: 51,076,443 (GRCm39) K1664Q probably benign Het
Tmod2 T C 9: 75,493,377 (GRCm39) K193E possibly damaging Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Ttc5 A T 14: 51,012,822 (GRCm39) Y189N probably damaging Het
Uox A G 3: 146,318,297 (GRCm39) H66R probably benign Het
Usp9y A T Y: 1,303,451 (GRCm39) D2487E probably benign Het
Vnn3 G A 10: 23,740,311 (GRCm39) G205R probably damaging Het
Vps11 T C 9: 44,260,294 (GRCm39) D856G probably benign Het
Zdhhc17 T C 10: 110,817,909 (GRCm39) N90D possibly damaging Het
Zfp105 T A 9: 122,758,743 (GRCm39) L138* probably null Het
Zfp28 A G 7: 6,397,875 (GRCm39) Y770C probably benign Het
Zfp655 T A 5: 145,181,594 (GRCm39) L484Q probably damaging Het
Zfp868 C A 8: 70,064,646 (GRCm39) E230* probably null Het
Zfpm2 A G 15: 40,966,419 (GRCm39) Y836C probably damaging Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87,473,514 (GRCm39) missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87,484,682 (GRCm39) missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87,484,644 (GRCm39) missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87,474,979 (GRCm39) missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87,473,414 (GRCm39) missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87,484,658 (GRCm39) missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87,329,613 (GRCm38) missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87,484,865 (GRCm39) missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87,484,577 (GRCm39) missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87,484,577 (GRCm39) missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87,474,932 (GRCm39) critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87,484,349 (GRCm39) missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87,484,508 (GRCm39) missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87,475,570 (GRCm39) missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87,475,065 (GRCm39) missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87,475,548 (GRCm39) missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87,475,005 (GRCm39) missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87,473,457 (GRCm39) missense probably damaging 1.00
R2104:Ugt2a3 UTSW 5 87,477,541 (GRCm39) splice site probably null
R2374:Ugt2a3 UTSW 5 87,475,050 (GRCm39) missense probably damaging 1.00
R3082:Ugt2a3 UTSW 5 87,473,534 (GRCm39) missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87,485,018 (GRCm39) missense
R3894:Ugt2a3 UTSW 5 87,477,449 (GRCm39) missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87,484,725 (GRCm39) missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87,475,548 (GRCm39) missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87,475,054 (GRCm39) missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87,479,144 (GRCm39) missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87,479,174 (GRCm39) missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87,475,059 (GRCm39) missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87,484,406 (GRCm39) missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87,484,336 (GRCm39) missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87,477,472 (GRCm39) missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87,484,617 (GRCm39) missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87,473,491 (GRCm39) missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87,484,953 (GRCm39) missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87,473,393 (GRCm39) missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87,484,479 (GRCm39) missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87,475,539 (GRCm39) critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87,475,582 (GRCm39) missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87,475,050 (GRCm39) missense probably damaging 1.00
R8803:Ugt2a3 UTSW 5 87,484,389 (GRCm39) missense probably damaging 0.98
R8886:Ugt2a3 UTSW 5 87,484,358 (GRCm39) missense probably damaging 1.00
R8944:Ugt2a3 UTSW 5 87,473,417 (GRCm39) missense possibly damaging 0.81
R9387:Ugt2a3 UTSW 5 87,484,832 (GRCm39) missense probably benign 0.38
R9447:Ugt2a3 UTSW 5 87,473,330 (GRCm39) missense probably benign 0.39
R9524:Ugt2a3 UTSW 5 87,485,018 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAAAAGGACTTCATTTTGCCTCTC -3'
(R):5'- CTACGGGATGCACAATATGATG -3'

Sequencing Primer
(F):5'- ACTTTCACATGTAGAGTTTTACACG -3'
(R):5'- TACGGGATGCACAATATGATGTAGTG -3'
Posted On 2014-09-18