Incidental Mutation 'R2119:Cyp2a12'
ID 231284
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
MMRRC Submission 040123-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2119 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 26728515-26736243 bp(+) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 26736071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 493 (*493W)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably null
Transcript: ENSMUST00000075552
AA Change: *493W
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: *493W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207016
Meta Mutation Damage Score 0.8636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,457,109 (GRCm39) L143M possibly damaging Het
Actbl2 G A 13: 111,391,694 (GRCm39) V10I probably benign Het
Adamts12 C T 15: 11,310,665 (GRCm39) T974I probably damaging Het
Aifm2 G A 10: 61,571,383 (GRCm39) V306M possibly damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Atxn7l3 C A 11: 102,182,807 (GRCm39) R278L possibly damaging Het
Bcl9 A G 3: 97,116,231 (GRCm39) L821P probably benign Het
Cdh19 C T 1: 110,847,320 (GRCm39) V430I probably benign Het
Clns1a T A 7: 97,363,111 (GRCm39) probably null Het
Col3a1 T A 1: 45,385,281 (GRCm39) C133S probably damaging Het
Csmd1 G A 8: 17,266,749 (GRCm39) T59I probably damaging Het
Cyp2j8 A T 4: 96,395,438 (GRCm39) D62E probably benign Het
Dcbld1 A T 10: 52,196,075 (GRCm39) M428L probably benign Het
Dhx32 A T 7: 133,323,976 (GRCm39) Y523* probably null Het
Dlgap2 C T 8: 14,828,206 (GRCm39) A538V possibly damaging Het
Dlgap3 T C 4: 127,129,982 (GRCm39) S919P probably benign Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dsc1 A T 18: 20,243,209 (GRCm39) H81Q probably benign Het
Dusp8 A T 7: 141,636,298 (GRCm39) S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 (GRCm39) T59S probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Ednrb T A 14: 104,059,204 (GRCm39) D274V probably benign Het
Eef1d G T 15: 75,775,062 (GRCm39) A199E probably benign Het
Eml3 T A 19: 8,911,718 (GRCm39) probably null Het
Enah G T 1: 181,749,318 (GRCm39) A138E probably damaging Het
Fgf18 A C 11: 33,068,003 (GRCm39) F129C probably damaging Het
Gba1 A T 3: 89,112,868 (GRCm39) E170V probably benign Het
Hdac1 C T 4: 129,416,157 (GRCm39) R212Q probably benign Het
Heatr1 T A 13: 12,447,527 (GRCm39) L1740Q probably null Het
Inhbb T A 1: 119,348,431 (GRCm39) H129L probably benign Het
Inpp5b T A 4: 124,691,662 (GRCm39) H862Q probably benign Het
Itsn2 C A 12: 4,757,025 (GRCm39) R1372S probably benign Het
Jaml T A 9: 45,012,362 (GRCm39) I283N probably damaging Het
Klk1b21 A T 7: 43,755,193 (GRCm39) T163S probably benign Het
Lmo3 A T 6: 138,393,492 (GRCm39) C43S probably damaging Het
Metrn C T 17: 26,014,197 (GRCm39) V210I probably benign Het
Ndufaf7 A T 17: 79,252,442 (GRCm39) I284F possibly damaging Het
Nlrp6 T C 7: 140,506,357 (GRCm39) V766A probably benign Het
Or10a5 A G 7: 106,635,938 (GRCm39) D192G probably damaging Het
Osbpl7 T C 11: 96,946,905 (GRCm39) S403P probably benign Het
Pabpc4l T C 3: 46,401,276 (GRCm39) T123A probably benign Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Pum1 C A 4: 130,396,581 (GRCm39) T112K possibly damaging Het
Rasgrp2 T A 19: 6,454,425 (GRCm39) M156K probably benign Het
Reln T A 5: 22,223,998 (GRCm39) E917V probably damaging Het
Rfc4 A T 16: 22,943,314 (GRCm39) V61E probably damaging Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Rtn4ip1 A G 10: 43,811,993 (GRCm39) probably null Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Scamp5 C A 9: 57,354,508 (GRCm39) V49F possibly damaging Het
Serhl A G 15: 82,999,776 (GRCm39) Q252R probably benign Het
Sestd1 T C 2: 77,042,867 (GRCm39) D229G probably benign Het
Slc35g1 T C 19: 38,391,735 (GRCm39) V339A probably benign Het
Slc9b2 T A 3: 135,034,743 (GRCm39) probably null Het
Stk40 C T 4: 126,022,640 (GRCm39) T138I probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Tep1 T G 14: 51,076,443 (GRCm39) K1664Q probably benign Het
Tmod2 T C 9: 75,493,377 (GRCm39) K193E possibly damaging Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Ttc5 A T 14: 51,012,822 (GRCm39) Y189N probably damaging Het
Ugt2a3 A T 5: 87,484,430 (GRCm39) M198K probably damaging Het
Uox A G 3: 146,318,297 (GRCm39) H66R probably benign Het
Usp9y A T Y: 1,303,451 (GRCm39) D2487E probably benign Het
Vnn3 G A 10: 23,740,311 (GRCm39) G205R probably damaging Het
Vps11 T C 9: 44,260,294 (GRCm39) D856G probably benign Het
Zdhhc17 T C 10: 110,817,909 (GRCm39) N90D possibly damaging Het
Zfp105 T A 9: 122,758,743 (GRCm39) L138* probably null Het
Zfp28 A G 7: 6,397,875 (GRCm39) Y770C probably benign Het
Zfp655 T A 5: 145,181,594 (GRCm39) L484Q probably damaging Het
Zfp868 C A 8: 70,064,646 (GRCm39) E230* probably null Het
Zfpm2 A G 15: 40,966,419 (GRCm39) Y836C probably damaging Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 26,736,036 (GRCm39) missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 26,732,008 (GRCm39) missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 26,730,583 (GRCm39) missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 26,731,967 (GRCm39) missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 26,730,631 (GRCm39) missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 26,729,017 (GRCm39) missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 26,734,198 (GRCm39) missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 26,734,198 (GRCm39) missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 26,736,046 (GRCm39) missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 26,733,563 (GRCm39) missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 26,731,967 (GRCm39) missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 26,731,967 (GRCm39) missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2120:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2121:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2122:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2124:Cyp2a12 UTSW 7 26,736,071 (GRCm39) makesense probably null
R2144:Cyp2a12 UTSW 7 26,734,194 (GRCm39) missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 26,732,042 (GRCm39) missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 26,729,057 (GRCm39) missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 26,730,571 (GRCm39) missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 26,734,057 (GRCm39) missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 26,728,700 (GRCm39) missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 26,730,640 (GRCm39) nonsense probably null
R4960:Cyp2a12 UTSW 7 26,733,575 (GRCm39) missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 26,736,046 (GRCm39) missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 26,736,036 (GRCm39) missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 26,735,888 (GRCm39) critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 26,730,643 (GRCm39) missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 26,728,550 (GRCm39) missense unknown
R5524:Cyp2a12 UTSW 7 26,730,656 (GRCm39) missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 26,728,504 (GRCm39) splice site probably null
R6320:Cyp2a12 UTSW 7 26,730,577 (GRCm39) missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 26,733,581 (GRCm39) missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 26,728,677 (GRCm39) missense probably benign 0.13
R8093:Cyp2a12 UTSW 7 26,736,054 (GRCm39) missense probably damaging 0.96
R8191:Cyp2a12 UTSW 7 26,730,529 (GRCm39) missense probably benign 0.00
R8259:Cyp2a12 UTSW 7 26,732,083 (GRCm39) nonsense probably null
R9083:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9084:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 26,735,944 (GRCm39) missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 26,734,785 (GRCm39) missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 26,734,845 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GATTCTGCTTGGGAGACAGC -3'
(R):5'- TTGCTGGATGAGTGACAGC -3'

Sequencing Primer
(F):5'- CCTGGCTAAGATGGAGCTGTTCC -3'
(R):5'- ACTGCTGCTCACTGTGTG -3'
Posted On 2014-09-18