Incidental Mutation 'R2119:Vps11'
ID 231294
Institutional Source Beutler Lab
Gene Symbol Vps11
Ensembl Gene ENSMUSG00000032127
Gene Name VPS11, CORVET/HOPS core subunit
Synonyms 1200011A11Rik
MMRRC Submission 040123-MU
Accession Numbers

Ncbi RefSeq: NM_027889.1; MGI:1918982
Essential gene? Essential (E-score: 1.000) question?
Stock # R2119 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44347749-44361670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44348997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 856 (D856G)
Ref Sequence ENSEMBL: ENSMUSP00000034644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034644] [ENSMUST00000077353] [ENSMUST00000214510]
AlphaFold Q91W86
Predicted Effect probably benign
Transcript: ENSMUST00000034644
AA Change: D856G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034644
Gene: ENSMUSG00000032127
AA Change: D856G

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
SCOP:d1erja_ 59 292 3e-10 SMART
Blast:WD40 73 117 2e-22 BLAST
Blast:WD40 125 168 9e-24 BLAST
Blast:WD40 175 214 6e-16 BLAST
Blast:WD40 219 259 2e-20 BLAST
Pfam:Clathrin 412 548 2.7e-16 PFAM
coiled coil region 775 813 N/A INTRINSIC
RING 822 860 6.14e-5 SMART
Pfam:VPS11_C 862 908 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077353
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216089
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Vps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Vps11 APN 9 44356219 splice site probably benign
IGL03135:Vps11 APN 9 44356356 missense probably benign 0.39
PIT4696001:Vps11 UTSW 9 44358189 missense possibly damaging 0.89
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0122:Vps11 UTSW 9 44354512 missense probably damaging 1.00
R0335:Vps11 UTSW 9 44353838 missense probably null 0.02
R0714:Vps11 UTSW 9 44359656 missense possibly damaging 0.90
R1068:Vps11 UTSW 9 44353019 missense probably damaging 1.00
R1873:Vps11 UTSW 9 44359936 missense probably damaging 1.00
R1991:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2068:Vps11 UTSW 9 44358316 missense probably damaging 0.99
R2084:Vps11 UTSW 9 44353261 missense probably benign 0.14
R2103:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R4160:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4161:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4564:Vps11 UTSW 9 44361597 missense probably damaging 1.00
R4879:Vps11 UTSW 9 44353300 missense probably benign
R5629:Vps11 UTSW 9 44356376 missense probably damaging 1.00
R5910:Vps11 UTSW 9 44359135 splice site probably null
R5988:Vps11 UTSW 9 44353924 missense probably benign 0.01
R6430:Vps11 UTSW 9 44361550 missense probably benign 0.11
R7002:Vps11 UTSW 9 44355079 missense probably damaging 1.00
R7147:Vps11 UTSW 9 44355082 nonsense probably null
R7237:Vps11 UTSW 9 44354506 missense probably damaging 1.00
R7261:Vps11 UTSW 9 44354503 missense probably damaging 1.00
R7577:Vps11 UTSW 9 44348961 missense probably benign 0.01
R8093:Vps11 UTSW 9 44356232 missense probably damaging 1.00
R8142:Vps11 UTSW 9 44354555 missense probably benign 0.05
R8238:Vps11 UTSW 9 44352760 missense probably benign 0.08
R8366:Vps11 UTSW 9 44355755 nonsense probably null
R8374:Vps11 UTSW 9 44356409 missense probably benign
R8731:Vps11 UTSW 9 44354459 missense probably benign 0.00
R8742:Vps11 UTSW 9 44355773 utr 3 prime probably benign
R9420:Vps11 UTSW 9 44356422 missense probably benign 0.14
R9474:Vps11 UTSW 9 44348993 nonsense probably null
R9625:Vps11 UTSW 9 44354441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAATCCTCTGGCACTC -3'
(R):5'- GGTTTCTGTGACCTCCCAAG -3'

Sequencing Primer
(F):5'- GGAAATTATCTCAGGTCCTCAAGAGC -3'
(R):5'- AAGGGACCGTGTGCATCCTG -3'
Posted On 2014-09-18