Incidental Mutation 'R0189:Plk2'
ID23137
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0189 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110399463 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 567 (T567M)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably damaging
Transcript: ENSMUST00000022212
AA Change: T567M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: T567M

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Meta Mutation Damage Score 0.1191 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Gm1110 T A 9: 26,883,218 E504V probably null Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Ino80 T A 2: 119,379,679 D1377V probably benign Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Olfr923 T A 9: 38,827,815 Y41* probably null Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Phf20 A G 2: 156,303,141 S890G probably benign Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rnf17 A G 14: 56,482,193 S967G probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
Mite UTSW 13 110396036 nonsense probably null
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R2987:Plk2 UTSW 13 110397709 missense probably benign 0.03
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4211:Plk2 UTSW 13 110396337 missense probably damaging 0.98
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R4777:Plk2 UTSW 13 110397773 missense probably benign
R5121:Plk2 UTSW 13 110399424 missense probably benign 0.01
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6596:Plk2 UTSW 13 110397762 missense probably benign 0.37
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
R7556:Plk2 UTSW 13 110396588 splice site probably null
Z1177:Plk2 UTSW 13 110395259 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCTTTTCAACAACGGGGCTCAC -3'
(R):5'- GCTGACTCTCTGCACTGCATCTAAG -3'

Sequencing Primer
(F):5'- GTCTGAATGCCGCAGCC -3'
(R):5'- gcactgcatctaagataagcc -3'
Posted On2013-04-16