Incidental Mutation 'R2120:Nlrp6'
ID 231379
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 040124-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2120 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140506357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 766 (V766A)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably benign
Transcript: ENSMUST00000106045
AA Change: V749A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: V749A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
AA Change: V736A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: V736A

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000184560
AA Change: V766A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: V766A

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Meta Mutation Damage Score 0.6903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,259,013 (GRCm39) probably benign Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Actrt2 C T 4: 154,751,551 (GRCm39) R195Q probably benign Het
Adamts12 C T 15: 11,310,665 (GRCm39) T974I probably damaging Het
Ankrd65 A G 4: 155,876,530 (GRCm39) T239A probably benign Het
Ano7 G T 1: 93,329,855 (GRCm39) probably benign Het
Apc A T 18: 34,409,654 (GRCm39) E198V probably damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Atp9a A T 2: 168,495,457 (GRCm39) V583E probably damaging Het
Bicral C T 17: 47,135,741 (GRCm39) A490T probably benign Het
C1rl C T 6: 124,485,672 (GRCm39) P348S probably damaging Het
Cog1 T C 11: 113,540,424 (GRCm39) L13P probably damaging Het
Cx3cr1 T A 9: 119,880,749 (GRCm39) T218S probably damaging Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
E2f4 A G 8: 106,026,973 (GRCm39) Y179C probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Endod1 T C 9: 14,268,949 (GRCm39) N179D probably benign Het
Epc2 C T 2: 49,437,621 (GRCm39) probably benign Het
Ets2 G T 16: 95,519,977 (GRCm39) R401L probably benign Het
Fgd4 C T 16: 16,243,692 (GRCm39) C614Y probably benign Het
Fgf18 A C 11: 33,068,003 (GRCm39) F129C probably damaging Het
Frem3 A T 8: 81,342,086 (GRCm39) T1460S probably benign Het
H2-M1 T G 17: 36,980,929 (GRCm39) T336P possibly damaging Het
Ikbkb T C 8: 23,157,233 (GRCm39) probably benign Het
Ipo7 G T 7: 109,648,838 (GRCm39) D704Y probably damaging Het
Jaml T A 9: 45,012,362 (GRCm39) I283N probably damaging Het
Jarid2 G T 13: 45,059,812 (GRCm39) M681I probably benign Het
Kif4-ps T C 12: 101,113,956 (GRCm39) L695P probably damaging Het
Kmt2d A G 15: 98,737,410 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,023 (GRCm39) T205A probably benign Het
Lif T C 11: 4,219,051 (GRCm39) V110A possibly damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Man2b1 A G 8: 85,819,653 (GRCm39) probably benign Het
Med16 A T 10: 79,738,916 (GRCm39) M290K possibly damaging Het
Mov10l1 C A 15: 88,891,830 (GRCm39) Q562K probably benign Het
Msantd2 C T 9: 37,434,227 (GRCm39) R357W probably damaging Het
Mtcl2 T C 2: 156,875,245 (GRCm39) E835G probably damaging Het
Mtmr6 T C 14: 60,534,108 (GRCm39) F449L probably damaging Het
Myt1l A T 12: 29,833,618 (GRCm39) probably null Het
Neb A G 2: 52,154,076 (GRCm39) F2345S probably damaging Het
Or11g27 T C 14: 50,771,403 (GRCm39) I178T probably damaging Het
Or4k36 A G 2: 111,145,844 (GRCm39) T7A probably benign Het
Or6d13 A T 6: 116,517,416 (GRCm39) M1L probably null Het
Or8k22 G A 2: 86,163,689 (GRCm39) R4C probably benign Het
Patj T A 4: 98,344,462 (GRCm39) D591E probably benign Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Pitpnm2 G A 5: 124,265,332 (GRCm39) P757L probably damaging Het
Plcd4 A G 1: 74,603,584 (GRCm39) T662A probably benign Het
Podn C T 4: 107,880,558 (GRCm39) A31T probably damaging Het
Prss37 G A 6: 40,492,294 (GRCm39) R186* probably null Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Pum1 C A 4: 130,396,581 (GRCm39) T112K possibly damaging Het
Rab3gap2 A T 1: 184,993,564 (GRCm39) D782V possibly damaging Het
Rasgrp2 T A 19: 6,454,425 (GRCm39) M156K probably benign Het
Reln G A 5: 22,174,083 (GRCm39) H2007Y probably damaging Het
Rhbdl2 T A 4: 123,718,712 (GRCm39) I222K probably damaging Het
Rimbp2 A G 5: 128,865,582 (GRCm39) S582P probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sars1 T C 3: 108,341,472 (GRCm39) I114V probably benign Het
Scamp5 C A 9: 57,354,508 (GRCm39) V49F possibly damaging Het
Sec14l1 C T 11: 117,039,358 (GRCm39) probably benign Het
Serpinb8 A G 1: 107,533,617 (GRCm39) E224G probably damaging Het
Setd2 A G 9: 110,378,932 (GRCm39) S632G probably benign Het
Slco6c1 C T 1: 96,993,808 (GRCm39) R645H possibly damaging Het
Srgn T A 10: 62,343,413 (GRCm39) probably benign Het
Stk40 C T 4: 126,022,640 (GRCm39) T138I probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Tada3 T C 6: 113,347,976 (GRCm39) I263V possibly damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tas2r115 T A 6: 132,714,470 (GRCm39) R160S possibly damaging Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Trp53bp2 A G 1: 182,269,204 (GRCm39) M223V probably benign Het
Ttc21b C T 2: 66,057,098 (GRCm39) V625I probably benign Het
Txnrd1 T A 10: 82,723,067 (GRCm39) C421S possibly damaging Het
Unc45a T C 7: 79,989,846 (GRCm39) T8A probably benign Het
Usp6nl T A 2: 6,445,748 (GRCm39) V552E probably damaging Het
Vmn2r115 T G 17: 23,578,297 (GRCm39) L590R probably damaging Het
Vmn2r88 A T 14: 51,650,665 (GRCm39) H126L probably benign Het
Vps13c A G 9: 67,826,616 (GRCm39) D1419G possibly damaging Het
Vwa3a A G 7: 120,391,641 (GRCm39) T776A probably benign Het
Zfp580 T C 7: 5,056,008 (GRCm39) Y123H probably damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1472:Nlrp6 UTSW 7 140,503,408 (GRCm39) missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140,502,076 (GRCm39) missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140,503,497 (GRCm39) missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140,502,725 (GRCm39) nonsense probably null
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGATCAGCCACTGGG -3'
(R):5'- AGCACGATGACCAAGTAATTGATC -3'

Sequencing Primer
(F):5'- TCAGCCACTGGGAACGACAG -3'
(R):5'- GACCAAGTAATTGATCACCTCTTGG -3'
Posted On 2014-09-18