Incidental Mutation 'R2120:Vmn2r88'
ID 231407
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r13, V2r3
MMRRC Submission 040124-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R2120 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 51648458-51656984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51650665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 126 (H126L)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: H126L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: H126L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159674
AA Change: H126L
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: H126L

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161565
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163019
AA Change: H101L
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: H101L

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: H126L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,259,013 (GRCm39) probably benign Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Actrt2 C T 4: 154,751,551 (GRCm39) R195Q probably benign Het
Adamts12 C T 15: 11,310,665 (GRCm39) T974I probably damaging Het
Ankrd65 A G 4: 155,876,530 (GRCm39) T239A probably benign Het
Ano7 G T 1: 93,329,855 (GRCm39) probably benign Het
Apc A T 18: 34,409,654 (GRCm39) E198V probably damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Atp9a A T 2: 168,495,457 (GRCm39) V583E probably damaging Het
Bicral C T 17: 47,135,741 (GRCm39) A490T probably benign Het
C1rl C T 6: 124,485,672 (GRCm39) P348S probably damaging Het
Cog1 T C 11: 113,540,424 (GRCm39) L13P probably damaging Het
Cx3cr1 T A 9: 119,880,749 (GRCm39) T218S probably damaging Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
E2f4 A G 8: 106,026,973 (GRCm39) Y179C probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Endod1 T C 9: 14,268,949 (GRCm39) N179D probably benign Het
Epc2 C T 2: 49,437,621 (GRCm39) probably benign Het
Ets2 G T 16: 95,519,977 (GRCm39) R401L probably benign Het
Fgd4 C T 16: 16,243,692 (GRCm39) C614Y probably benign Het
Fgf18 A C 11: 33,068,003 (GRCm39) F129C probably damaging Het
Frem3 A T 8: 81,342,086 (GRCm39) T1460S probably benign Het
H2-M1 T G 17: 36,980,929 (GRCm39) T336P possibly damaging Het
Ikbkb T C 8: 23,157,233 (GRCm39) probably benign Het
Ipo7 G T 7: 109,648,838 (GRCm39) D704Y probably damaging Het
Jaml T A 9: 45,012,362 (GRCm39) I283N probably damaging Het
Jarid2 G T 13: 45,059,812 (GRCm39) M681I probably benign Het
Kif4-ps T C 12: 101,113,956 (GRCm39) L695P probably damaging Het
Kmt2d A G 15: 98,737,410 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,023 (GRCm39) T205A probably benign Het
Lif T C 11: 4,219,051 (GRCm39) V110A possibly damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Man2b1 A G 8: 85,819,653 (GRCm39) probably benign Het
Med16 A T 10: 79,738,916 (GRCm39) M290K possibly damaging Het
Mov10l1 C A 15: 88,891,830 (GRCm39) Q562K probably benign Het
Msantd2 C T 9: 37,434,227 (GRCm39) R357W probably damaging Het
Mtcl2 T C 2: 156,875,245 (GRCm39) E835G probably damaging Het
Mtmr6 T C 14: 60,534,108 (GRCm39) F449L probably damaging Het
Myt1l A T 12: 29,833,618 (GRCm39) probably null Het
Neb A G 2: 52,154,076 (GRCm39) F2345S probably damaging Het
Nlrp6 T C 7: 140,506,357 (GRCm39) V766A probably benign Het
Or11g27 T C 14: 50,771,403 (GRCm39) I178T probably damaging Het
Or4k36 A G 2: 111,145,844 (GRCm39) T7A probably benign Het
Or6d13 A T 6: 116,517,416 (GRCm39) M1L probably null Het
Or8k22 G A 2: 86,163,689 (GRCm39) R4C probably benign Het
Patj T A 4: 98,344,462 (GRCm39) D591E probably benign Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Pitpnm2 G A 5: 124,265,332 (GRCm39) P757L probably damaging Het
Plcd4 A G 1: 74,603,584 (GRCm39) T662A probably benign Het
Podn C T 4: 107,880,558 (GRCm39) A31T probably damaging Het
Prss37 G A 6: 40,492,294 (GRCm39) R186* probably null Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Pum1 C A 4: 130,396,581 (GRCm39) T112K possibly damaging Het
Rab3gap2 A T 1: 184,993,564 (GRCm39) D782V possibly damaging Het
Rasgrp2 T A 19: 6,454,425 (GRCm39) M156K probably benign Het
Reln G A 5: 22,174,083 (GRCm39) H2007Y probably damaging Het
Rhbdl2 T A 4: 123,718,712 (GRCm39) I222K probably damaging Het
Rimbp2 A G 5: 128,865,582 (GRCm39) S582P probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sars1 T C 3: 108,341,472 (GRCm39) I114V probably benign Het
Scamp5 C A 9: 57,354,508 (GRCm39) V49F possibly damaging Het
Sec14l1 C T 11: 117,039,358 (GRCm39) probably benign Het
Serpinb8 A G 1: 107,533,617 (GRCm39) E224G probably damaging Het
Setd2 A G 9: 110,378,932 (GRCm39) S632G probably benign Het
Slco6c1 C T 1: 96,993,808 (GRCm39) R645H possibly damaging Het
Srgn T A 10: 62,343,413 (GRCm39) probably benign Het
Stk40 C T 4: 126,022,640 (GRCm39) T138I probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Tada3 T C 6: 113,347,976 (GRCm39) I263V possibly damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tas2r115 T A 6: 132,714,470 (GRCm39) R160S possibly damaging Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Trp53bp2 A G 1: 182,269,204 (GRCm39) M223V probably benign Het
Ttc21b C T 2: 66,057,098 (GRCm39) V625I probably benign Het
Txnrd1 T A 10: 82,723,067 (GRCm39) C421S possibly damaging Het
Unc45a T C 7: 79,989,846 (GRCm39) T8A probably benign Het
Usp6nl T A 2: 6,445,748 (GRCm39) V552E probably damaging Het
Vmn2r115 T G 17: 23,578,297 (GRCm39) L590R probably damaging Het
Vps13c A G 9: 67,826,616 (GRCm39) D1419G possibly damaging Het
Vwa3a A G 7: 120,391,641 (GRCm39) T776A probably benign Het
Zfp580 T C 7: 5,056,008 (GRCm39) Y123H probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51,650,713 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,517 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,650,582 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51,654,259 (GRCm39) missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51,655,437 (GRCm39) missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL02483:Vmn2r88 APN 14 51,651,611 (GRCm39) missense probably benign
IGL03241:Vmn2r88 APN 14 51,655,830 (GRCm39) missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51,651,597 (GRCm39) missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51,651,959 (GRCm39) missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51,655,666 (GRCm39) missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51,656,007 (GRCm39) missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51,654,244 (GRCm39) missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51,650,487 (GRCm39) splice site probably benign
R1911:Vmn2r88 UTSW 14 51,655,671 (GRCm39) missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51,655,651 (GRCm39) missense probably damaging 1.00
R2126:Vmn2r88 UTSW 14 51,651,264 (GRCm39) missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51,651,461 (GRCm39) missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51,656,146 (GRCm39) missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51,651,391 (GRCm39) missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51,656,089 (GRCm39) missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51,651,435 (GRCm39) missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51,650,647 (GRCm39) missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51,652,883 (GRCm39) missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51,650,746 (GRCm39) nonsense probably null
R4397:Vmn2r88 UTSW 14 51,655,435 (GRCm39) missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51,655,538 (GRCm39) missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51,655,531 (GRCm39) missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51,656,250 (GRCm39) missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51,655,612 (GRCm39) missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51,650,791 (GRCm39) missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51,650,796 (GRCm39) missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51,650,702 (GRCm39) missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51,650,638 (GRCm39) missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51,648,603 (GRCm39) missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51,651,367 (GRCm39) missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51,656,029 (GRCm39) missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51,655,606 (GRCm39) nonsense probably null
R6103:Vmn2r88 UTSW 14 51,652,826 (GRCm39) missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51,651,795 (GRCm39) missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51,651,426 (GRCm39) missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51,656,100 (GRCm39) missense
R7104:Vmn2r88 UTSW 14 51,651,253 (GRCm39) missense
R7265:Vmn2r88 UTSW 14 51,655,776 (GRCm39) missense
R7316:Vmn2r88 UTSW 14 51,651,712 (GRCm39) missense
R7552:Vmn2r88 UTSW 14 51,648,315 (GRCm39) splice site probably null
R7611:Vmn2r88 UTSW 14 51,651,454 (GRCm39) missense
R7667:Vmn2r88 UTSW 14 51,655,446 (GRCm39) missense
R7682:Vmn2r88 UTSW 14 51,655,906 (GRCm39) missense
R7755:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51,656,160 (GRCm39) missense
R7882:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51,650,589 (GRCm39) missense
R7998:Vmn2r88 UTSW 14 51,651,565 (GRCm39) missense
R8142:Vmn2r88 UTSW 14 51,651,564 (GRCm39) missense
R8186:Vmn2r88 UTSW 14 51,656,157 (GRCm39) missense
R8348:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51,656,253 (GRCm39) missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51,650,530 (GRCm39) missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51,651,523 (GRCm39) missense
R8859:Vmn2r88 UTSW 14 51,656,263 (GRCm39) missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51,648,593 (GRCm39) missense
R8936:Vmn2r88 UTSW 14 51,655,983 (GRCm39) missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51,650,624 (GRCm39) missense
R9038:Vmn2r88 UTSW 14 51,651,490 (GRCm39) missense
R9063:Vmn2r88 UTSW 14 51,648,329 (GRCm39) start gained probably benign
R9311:Vmn2r88 UTSW 14 51,650,503 (GRCm39) missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51,656,197 (GRCm39) missense
R9483:Vmn2r88 UTSW 14 51,648,641 (GRCm39) missense
R9602:Vmn2r88 UTSW 14 51,651,189 (GRCm39) missense
V5622:Vmn2r88 UTSW 14 51,650,584 (GRCm39) missense probably benign
X0024:Vmn2r88 UTSW 14 51,651,289 (GRCm39) missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51,654,259 (GRCm39) missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51,655,644 (GRCm39) missense
Z1177:Vmn2r88 UTSW 14 51,655,503 (GRCm39) frame shift probably null
Z1190:Vmn2r88 UTSW 14 51,650,658 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CACTATGCCTTCTTTTAGAATTGCAGC -3'
(R):5'- GTAGCAGCACACTCACAAATGTG -3'

Sequencing Primer
(F):5'- GCCTTCTTTTAGAATTGCAGCAAGTG -3'
(R):5'- GCACACTCACAAATGTGTTCTC -3'
Posted On 2014-09-18