Incidental Mutation 'R2121:Gstm7'
ID231437
Institutional Source Beutler Lab
Gene Symbol Gstm7
Ensembl Gene ENSMUSG00000004035
Gene Nameglutathione S-transferase, mu 7
SynonymsCd203c, 0610005A07Rik
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R2121 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107926334-107931817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107926914 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 175 (M175V)
Ref Sequence ENSEMBL: ENSMUSP00000102298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004137] [ENSMUST00000106687] [ENSMUST00000106688] [ENSMUST00000124215] [ENSMUST00000133947]
Predicted Effect probably benign
Transcript: ENSMUST00000004137
AA Change: M212V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004137
Gene: ENSMUSG00000004035
AA Change: M212V

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.2e-23 PFAM
Pfam:GST_C_3 42 190 1.2e-9 PFAM
Pfam:GST_C 104 191 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106687
AA Change: M175V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102298
Gene: ENSMUSG00000004035
AA Change: M175V

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.8e-24 PFAM
Pfam:GST_N_3 11 93 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106688
AA Change: M208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102299
Gene: ENSMUSG00000004035
AA Change: M208V

DomainStartEndE-ValueType
Pfam:GST_N_3 4 89 8.8e-7 PFAM
Pfam:GST_N 5 78 4.2e-19 PFAM
Pfam:GST_C 100 188 5.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124215
SMART Domains Protein: ENSMUSP00000118707
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 1 72 8.6e-20 PFAM
Pfam:GST_N_3 3 83 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133947
SMART Domains Protein: ENSMUSP00000122567
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GST_N 45 123 2.6e-19 PFAM
Pfam:GST_N_3 54 134 1.4e-6 PFAM
Meta Mutation Damage Score 0.1077 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Gstm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Gstm7 APN 3 107930278 missense possibly damaging 0.93
PIT4142001:Gstm7 UTSW 3 107931483 frame shift probably null
R0095:Gstm7 UTSW 3 107930563 splice site probably benign
R0961:Gstm7 UTSW 3 107926986 unclassified probably benign
R1052:Gstm7 UTSW 3 107926950 missense probably benign 0.05
R4610:Gstm7 UTSW 3 107926919 missense possibly damaging 0.65
R5966:Gstm7 UTSW 3 107931431 intron probably benign
R6393:Gstm7 UTSW 3 107930826 critical splice donor site probably null
R7014:Gstm7 UTSW 3 107926962 missense probably benign 0.00
R7052:Gstm7 UTSW 3 107931317 missense probably damaging 0.96
R7741:Gstm7 UTSW 3 107931647 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGGCAGAGATTGGATGACC -3'
(R):5'- ACAGGCATCTTCGCATAGGC -3'

Sequencing Primer
(F):5'- TGGATGACCAAAAACGAGAGCC -3'
(R):5'- ATCTTCGCATAGGCCACCGAG -3'
Posted On2014-09-18