Incidental Mutation 'R2121:Abcg5'
ID231485
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R2121 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84671147 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 294 (E294D)
Ref Sequence ENSEMBL: ENSMUSP00000069495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect probably benign
Transcript: ENSMUST00000066175
AA Change: E294D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: E294D

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172439
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2124:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2858:Abcg5 UTSW 17 84670220 critical splice donor site probably null
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R4963:Abcg5 UTSW 17 84660141 nonsense probably null
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5348:Abcg5 UTSW 17 84671206 missense possibly damaging 0.92
R5445:Abcg5 UTSW 17 84671129 missense probably damaging 1.00
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
R7303:Abcg5 UTSW 17 84670346 missense probably damaging 1.00
R7324:Abcg5 UTSW 17 84676239 missense possibly damaging 0.82
R7639:Abcg5 UTSW 17 84670103 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGTCATCCATGCCAAAATC -3'
(R):5'- CTGGGACTCAGAGGCATATAAC -3'

Sequencing Primer
(F):5'- TGATCCCTAGAAGCCATGTCG -3'
(R):5'- TGGGACTCAGAGGCATATAACAACAC -3'
Posted On2014-09-18